Sequence Alignment - PowerPoint PPT Presentation

About This Presentation
Title:

Sequence Alignment

Description:

sequence alignment aggctatcacctgacctccaggccgatgccc tagctatcacgaccgcggtcgatttgcccgac-aggctatcacctgacctccaggccga--tgccc---tag-ctatcac--gaccgc--ggtcgatttgcccgac – PowerPoint PPT presentation

Number of Views:130
Avg rating:3.0/5.0
Slides: 67
Provided by: NirF59
Category:

less

Transcript and Presenter's Notes

Title: Sequence Alignment


1
Sequence Alignment
AGGCTATCACCTGACCTCCAGGCCGATGCCC TAGCTATCACGACCGCGG
TCGATTTGCCCGAC
-AGGCTATCACCTGACCTCCAGGCCGA--TGCCC--- TAG-CTATCAC-
-GACCGC--GGTCGATTTGCCCGAC
Definition Given two strings x x1x2...xM, y
y1y2yN, an alignment is an assignment of
gaps to positions 0,, N in x, and 0,, N in y,
so as to line up each letter in one sequence
with either a letter, or a gap in the other
sequence
2
Sequence Comparison
  • Much of bioinformatics involves sequences
  • DNA sequences
  • RNA sequences
  • Protein sequences
  • We can think of these sequences as strings of
    letters
  • DNA RNA alphabet ? of 4 letters
  • Protein alphabet ? of 20 letters

3
Sequence Comparison
  • Finding similarity between sequences is important
    for many biological questions
  • During evolution biological evolves (mutation,
    deletion, duplication, addition, move of
    subsequences)
  • Homologous (share a common ancestor) sequences
    are (relatively) similar
  • Algorithms try to detect similar sequence that
    possibly share a common function

4
Sequence Comparison (cont)
  • For example
  • Find similar proteins
  • Allows to predict function structure
  • Locate similar subsequences in DNA
  • Allows to identify (e.g) regulatory elements
  • Locate DNA sequences that might overlap
  • Helps in sequence assembly

5
Sequence Alignment
  • Input two sequences over the same alphabet
  • Output an alignment of the two sequences
  • Example
  • GCGCATGGATTGAGCGA
  • TGCGCCATTGATGACCA
  • A possible alignment
  • -GCGC-ATGGATTGAGCGA
  • TGCGCCATTGAT-GACC-A

6
Alignments
  • -GCGC-ATGGATTGAGCGA
  • TGCGCCATTGAT-GACC-A
  • Three elements
  • Matches
  • Mismatches
  • Insertions deletions (indel)

7
Choosing Alignments
  • There are many possible alignments
  • For example, compare
  • -GCGC-ATGGATTGAGCGA
  • TGCGCCATTGAT-GACC-A
  • to
  • ------GCGCATGGATTGAGCGA
  • TGCGCC----ATTGATGACCA--
  • Which one is better?

8
Scoring Alignments
  • Intuition
  • Similar sequences evolved from a common ancestor
  • Evolution changed the sequences from this
    ancestral sequence by mutations
  • Substitution one letter replaced by another
  • Deletion deletion of a letter
  • Insertion insertion of a letter
  • Scoring of sequence similarity should examine how
    many and which operations took place

9
Simple Scoring Rule
  • Score each position independently
  • Match m 1
  • Mismatch s -1
  • Indel d -2
  • Score of an alignment is sum of position scores
  • Scoring Function
  • Match m m0
  • Mismatch s s0
  • Gap d s0
  • Score F (matches)?m (mismatches)?s
    (gaps)?d

10
Example
  • Example
  • -GCGC-ATGGATTGAGCGA
  • TGCGCCATTGAT-GACC-A
  • Score (1x13) (-1x2) (-2x4) 3
  • ------GCGCATGGATTGAGCGA
  • TGCGCC----ATTGATGACCA--
  • Score (1x5) (-1x6) (-2x11) -23

11
More General Scores
  • The choice of 1,-1, and -2 scores is quite
    arbitrary
  • Depending on the context, some changes are more
    plausible than others
  • Exchange of an amino-acid by one with similar
    properties (size, charge, etc.)
  • Exchange of an amino-acid by one with opposite
    properties
  • Probabilistic interpretation (e.g.) How likely
    is one alignment versus another ?

12
Additive Scoring Rules
  • We define a scoring function by specifying a
    function
  • ?(x,y) is the score of replacing x by y
  • ?(x,-) is the score of deleting x
  • ?(-,x) is the score of inserting x
  • The score of an alignment is the sum of position
    scores

13
How do we compute the best alignment?
AGTGCCCTGGAACCCTGACGGTGGGTCACAAAACTTCTGGA
  • Alignment is a path from cell (0,0) to cell
    (m,n)
  • Too many possible alignments
  • O( 2MN)

AGTGACCTGGGAAGACCCTGACCCTGGGTCACAAAACTC
14
The Optimal Score
  • The optimal alignment score between two sequences
    is the maximal score over all alignments of these
    sequences
  • Computing the maximal score or actually finding
    an alignment that yields the maximal score are
    closely related tasks with similar algorithms.
  • We now address these two problems.

15
Alignment is additive
  • Observation
  • The score of aligning x1xM
  • y1yN
  • is additive
  • Say that x1xi xi1xM
  • aligns to y1yj yj1yN
  • The two scores add up
  • V(x1M, y1N) V(x1i, y1j)
    V(xi1M, yj1N)

16
Dynamic Programming
  • We will now describe a dynamic programming
    algorithm
  • Suppose we wish to align
  • x1xM
  • y1yN
  • Let
  • V(i,j) optimal score of aligning
  • x1xi
  • y1yj

17
Dynamic Programming
  • Notice three possible cases
  • xi aligns to yj
  • x1xi-1 xi
  • y1yj-1 yj
  • 2. xi aligns to a gap
  • x1xi-1 xi
  • y1yj -
  • yj aligns to a gap
  • x1xi -
  • y1yj-1 yj

m, if xi yj V(i,j) V(i-1, j-1)
s, if not
V(i,j) V(i-1, j) d
V(i,j) V(i, j-1) d
18
Dynamic Programming
  • How do we know which case is correct?
  • Inductive assumption
  • V(i, j-1), V(i-1, j), V(i-1, j-1) are optimal
  • Then,
  • V(i-1, j-1) s(xi, yj)
  • V(i, j) max V(i-1, j) d
  • V( i, j-1) d
  • Where s(xi, yj) m, if xi yj s, if not

19
Recursive Argument
  • Define the notation
  • Using our recursive argument, we get the
    following recurrence for V

Vi,j Vi1,j
Vi,j1 Vi1,j1
20
Recursive Argument
  • Of course, we also need to handle the base cases
    in the recursion

AA - -
versus
We fill the matrix using the recurrence rule
21
Dynamic Programming Algorithm
We continue to fill the matrix using the
recurrence rule
22
Dynamic Programming Algorithm
V0,0 V0,1
V1,0 V1,1
versus
23
Dynamic Programming Algorithm
24
Dynamic Programming Algorithm
25
Reconstructing the Best Alignment
  • To reconstruct the best alignment, we record
    which case(s) in the recursive rule maximized the
    score

26
Reconstructing the Best Alignment
  • We now trace back a path that corresponds to the
    best alignment

27
Reconstructing the Best Alignment
  • Sometimes, more than one alignment has the best
    score

AAAC A-GC
28
The Needleman-Wunsch Matrix
x1 xM
Every nondecreasing path from (0,0) to (M, N)
corresponds to an alignment of the two
sequences
y1 yN
An optimal alignment is composed of optimal
subalignments
29
The Needleman-Wunsch AlgorithmGlobal Alignment
Algorithm
  • Initialization.
  • F(0, 0) 0
  • F(0, j) j ? d
  • F(i, 0) i ? d
  • Main Iteration. Filling-in partial alignments
  • For each i 1M
  • For each j 1N
  • F(i-1,j-1) s(xi, yj) case 1
  • F(i, j) max F(i-1, j) d case
    2
  • F(i, j-1) d case 3
  • DIAG, if case 1
  • Ptr(i,j) LEFT, if case 2
  • UP, if case 3
  • Termination. F(M, N) is the optimal score, and
  • from Ptr(M, N) can trace back optimal alignment

30
Time Complexity
  • Space O(mn)
  • Time O(mn)
  • Filling the matrix O(mn)
  • Backtrace O(mn)

31
Space Complexity
  • In real-life applications, n and m can be very
    large
  • The space requirements of O(mn) can be too
    demanding
  • If m n 1000, we need 1MB space
  • If m n 10000, we need 100MB space
  • We can afford to perform extra computation to
    save space
  • Looping over million operations takes less than
    seconds on modern workstations
  • Can we trade space with time?

32
Why Do We Need So Much Space?
To compute Vn,md(s1..n,t1..m), we need
only O(min(n,m)) space
  • Compute V(i,j), column by column, storing only
    two columns in memory (or line by line if lines
    are shorter).
  • Note however that
  • This trick fails when we need to reconstruct
    the optimizing sequence.
  • Trace back information requires O(mn) memory
    bytes.

33
Space Efficient Version Outline
Input Sequences s1,n and t1,m to be
aligned. Idea perform divide and conquer
  • If n1 align s1,1 and t1,m
  • Else, find position (n/2, j) at which some best
    alignment crosses a midpoint
  • Construct alignments
  • As1,n/2 vs t1,j
  • Bsn/21,n vs tj1,m
  • Return AB

34
Finding the Midpoint
  • The score of the best alignment that goes through
    j equals
  • d(s1,n/2,t1,j) d(sn/21,n,tj1,m)
  • Thus, we need to compute these two quantities for
    all values of j

35
Finding the Midpoint (Algorithm)
  • Define
  • Fi,j d(s1,i,t1,j)
  • Bi,j d(si1,n,tj1,m)
  • Fi,j Bi,j score of best alignment through
    (i,j)
  • We compute Fi,j as we did before
  • We compute Bi,j in exactly the same manner,
    going backward from Bn,m
  • Requires linear space complexity
  • because there is no need to keep trace back
    information in this step

36
Time Complexity Analysis
  • Time to find a mid-point cnm (c - a constant)
  • Size of recursive sub-problems is (n/2,j) and
    (n/2,m-j-1), hence
  • T(n,m) cnm T(n/2,j) T(n/2,m-j-1)
  • Lemma T(n,m) ? 2cnm

Proof (by induction) T(n,m) ? cnm 2c(n/2)j
2c(n/2)(m-j-1) ? 2cnm.
Thus, time complexity is linear in size of the
problem At worst, twice the cost of the regular
solution.
37
A variant of the NW algorithm
  • Maybe it is OK to have an unlimited of gaps in
    the beginning and end

----------CTATCACCTGACCTCCAGGCCGATGCCCCTTCCGGC GCG
AGTTCATCTATCAC--GACCGC--GGTCG--------------
  • Then, we dont want to penalize gaps in the ends

38
Different types of overlaps
39
The Overlap Detection variant
  • Changes
  • Initialization
  • For all i, j,
  • V(i, 0) 0
  • V(0, j) 0
  • Termination
  • maxi V(i, N)
  • VOPT max maxj V(M, j)

x1 xM
y1 yN
40
Overlap Alignment Example
s PAWHEAE t HEAGAWGHEE
  • Scoring system
  • Match 4
  • Mismatch -1
  • Indel -5

41
Overlap Alignment
  • Initialization Vi,00 , V0,j0
  • Recurrence as in global alignment
  • Score maximum value at the bottom line and
    rightmost line in the matrix

42
Overlap Alignment Example
s PAWHEAE t HEAGAWGHEE
  • Scoring system
  • Match 4
  • Mismatch -1
  • Indel -5

43
Overlap Alignment Example
s PAWHEAE t HEAGAWGHEE
  • Scoring system
  • Match 4
  • Mismatch -1
  • Indel -5

44
Overlap Alignment Example
The best overlap is PAWHEAE------
---HEAGAWGHEE
  • Pay attention! A different scoring system could
    yield a different result, such as
  • ---PAW-HEAE
  • HEAGAWGHEE-

45
The local alignment problem
  • Given two strings x x1xM,
  • y y1yN
  • Find substrings x, y whose similarity
  • (optimal global alignment value)
  • is maximum
  • e.g. x aaaacccccgggg
  • y cccgggaaccaacc

46
Why local alignment
  • Genes are shuffled between genomes
  • Portions of proteins (domains) are often conserved

47
Cross-species genome similarity
  • 98 of genes are conserved between any two
    mammals
  • gt70 average similarity in protein sequence

hum_a GTTGACAATAGAGGGTCTGGCAGAGGCTC------------
--------- _at_ 57331/400001 mus_a
GCTGACAATAGAGGGGCTGGCAGAGGCTC---------------------
_at_ 78560/400001 rat_a GCTGACAATAGAGGGGCTGGCAGAGA
CTC--------------------- _at_ 112658/369938 fug_a
TTTGTTGATGGGGAGCGTGCATTAATTTCAGGCTATTGTTAACAGGCTCG
_at_ 36008/68174 hum_a CTGGCCGCGGTGCGGAGCGTCTGGA
GCGGAGCACGCGCTGTCAGCTGGTG _at_ 57381/400001 mus_a
CTGGCCCCGGTGCGGAGCGTCTGGAGCGGAGCACGCGCTGTCAGCTGGTG
_at_ 78610/400001 rat_a CTGGCCCCGGTGCGGAGCGTCTGGAG
CGGAGCACGCGCTGTCAGCTGGTG _at_ 112708/369938 fug_a
TGGGCCGAGGTGTTGGATGGCCTGAGTGAAGCACGCGCTGTCAGCTGGCG
_at_ 36058/68174 hum_a AGCGCACTCTCCTTTCAGGCAGCT
CCCCGGGGAGCTGTGCGGCCACATTT _at_ 57431/400001 mus_a
AGCGCACTCG-CTTTCAGGCCGCTCCCCGGGGAGCTGAGCGGCCACATTT
_at_ 78659/400001 rat_a AGCGCACTCG-CTTTCAGGCCGCTCC
CCGGGGAGCTGCGCGGCCACATTT _at_ 112757/369938 fug_a
AGCGCTCGCG------------------------AGTCCCTGCCGTGTCC
_at_ 36084/68174 hum_a AACACCATCATCACCCCTCCCCGGC
CTCCTCAACCTCGGCCTCCTCCTCG _at_ 57481/400001 mus_a
AACACCGTCGTCA-CCCTCCCCGGCCTCCTCAACCTCGGCCTCCTCCTCG
_at_ 78708/400001 rat_a AACACCGTCGTCA-CCCTCCCCGGCC
TCCTCAACCTCGGCCTCCTCCTCG _at_ 112806/369938 fug_a
CCGAGGACCCTGA-------------------------------------
_at_ 36097/68174
atoh enhancer in human, mouse, rat, fugu fish
48
Local Alignment
  • As before, we use dynamic programming
  • We now want to setVi,j to record the best
    alignment of a suffix of s1..i and a suffix of
    t1..j
  • How should we change the recurrence rule?
  • Same as before but with an option to start afresh
  • The result is called the Smith-Waterman algorithm

49
The Smith-Waterman algorithm
  • Idea Ignore badly aligning regions
  • Modifications to Needleman-Wunsch
  • Initialization V(0, j) V(i, 0) 0
  • 0
  • Iteration V(i, j) max V(i 1, j) d
  • V(i, j 1) d
  • V(i 1, j 1) s(xi, yj)

50
The Smith-Waterman algorithm
  • Termination
  • If we want the best local alignment
  • VOPT maxi,j V(i, j)
  • If we want all local alignments scoring gt t
  • ?? For all i, j find V(i, j) gt t, and trace back
  • Complicated by overlapping local alignments

51
Local Alignment
  • New option
  • We can start a new match instead of extending a
    previous alignment

Alignment of empty suffixes
52
Local Alignment Example
s TAATA t TACTAA
53
Local Alignment Example
s TAATA t TACTAA
54
Local Alignment Example
s TAATA t TACTAA
55
Local Alignment Example
s TAATA t TACTAA
56
Local Alignment Example
s TAATA t TACTAA
57
Alignment with gaps
  • Observation Insertions and deletions often occur
    in blocks longer than a single nucleotide.
  • Consequence Standard scoring of alignment
    studied in lecture, which give a constant penalty
    d per gap unit , does not score well this
    phenomenon Hence, a better gap score model is
    needed.
  • Question Can you think of an appropriate change
    to the scoring system for gaps?

58
Scoring the gaps more accurately
  • Current model
  • Gap of length n
  • incurs penalty n?d
  • However, gaps usually occur in bunches
  • Convex gap penalty function
  • ?(n)
  • for all n, ?(n 1) - ?(n) ? ?(n) - ?(n 1)

?(n)
?(n)
59
Convex gap alignment
  • Initialization same
  • Iteration
  • V(i-1, j-1) s(xi, yj)
  • V(i, j) max maxk0i-1V(k,j) ?(i-k)
  • maxk0j-1V(i,k) ?(j-k)
  • Termination same
  • Running Time O(N2M) (assume NgtM)
  • Space O(NM)

60
Compromise affine gaps
?(n)
  • ?(n) d (n 1)?e
  • gap gap
  • open extend
  • To compute optimal alignment,
  • At position i,j, need to remember best score if
    gap is open
  • best score if gap is not open
  • F(i, j) score of alignment x1xi to y1yj
  • if xi aligns to yj
  • G(i, j) score if xi aligns to a gap after yj
  • H(i, j) score if yj aligns to a gap after xi
  • V(i, j) best score of alignment x1xi to
    y1yj

e
d
61
Needleman-Wunsch with affine gaps
  • Why do we need two matrices?
  • xi aligns to yj
  • x1xi-1 xi xi1
  • y1yj-1 yj -
  • 2. xi aligns to a gap
  • x1xi-1 xi xi1
  • y1yj - -

Add -d
Add -e
62
Needleman-Wunsch with affine gaps
  • Initialization V(i, 0) d (i 1)?e
  • V(0, j) d (j 1)?e
  • Iteration
  • V(i, j) max F(i, j), G(i, j), H(i, j)
  • F(i, j) V(i 1, j 1) s(xi, yj)
  • V(i, j 1) d
  • G(i, j) max
  • G(i, j 1) e
  • V(i 1, j) d
  • H(i, j) max
  • H(i 1, j) e
  • Termination similar

63
To generalize a little
  • think of how you would compute optimal
    alignment with this gap function

?(n)
.in time O(MN)
64
Remark Edit Distance
  • Instead of speaking about the score of an
    alignment, one often talks about an edit distance
    between two sequences, defined to be the cost
    of the cheapest set of edit operations needed
    to transform one sequence into the other.
  • Cheapest operation is no change
  • Next cheapest operation is replace
  • The most expensive operation is add space.
  • Our goal is now to minimize the cost of
    operations, which is exactly what we actually
    did.

65
Where do scoring rules come from ?
  • We have defined an additive scoring function by
    specifying a function ?( ?, ? ) such that
  • ?(x,y) is the score of replacing x by y
  • ?(x,-) is the score of deleting x
  • ?(-,x) is the score of inserting x
  • But how do we come up with the correct score ?

Answer By encoding experience of what are
similar sequences for the task at hand.
66
Probabilistic Interpretation of Scores
  • We define the scoring function via
  • Then, the score of an alignment is the log-ratio
    between the two models
  • Score gt 0 ? Model is more likely
  • Score lt 0 ? Random is more likely

67
Modeling Assumptions
  • It is important to note that this interpretation
    depends on our modeling assumption!!
  • For example, if we assume that the letter in each
    position depends on the letter in the preceding
    position, then the likelihood ratio will have a
    different form.

68
Constructing Scoring Rules
  • The formula
  • suggests how to construct a scoring rule
  • Estimate p(,) and q() from the data
  • Compute ?(a,b) based on the estimated p(,) and
    q()
  • How to estimate these parameters is the subject
    matter of parameter estimation in Statistics.

69
Substitution matrix
  • There exist several matrix based on this scoring
    scheme but differing by the way the statistic is
    computed
  • The two major one are PAM and BLOSUM
  • PAM 1 correspond to statistics computed from an
    global alignments of proteins with at most 1 of
    mutations
  • Other PAM matrix (until PAM 250) are extrapolated
    by matrix products
  • BLOSUM 62 correspond to statistics from local
    alignments with 62 of similarity.
  • Other BLOSUM matrix are build from other
    alignments

PAM100 gt Blosum90 PAM120 gt Blosum80 PAM160
gt Blosum60 PAM200 gt Blosum52 PAM250 gt
Blosum45
Write a Comment
User Comments (0)
About PowerShow.com