Bioinformatics Methods Course Multiple Sequence Alignment Burkhard Morgenstern University of G - PowerPoint PPT Presentation

About This Presentation

Bioinformatics Methods Course Multiple Sequence Alignment Burkhard Morgenstern University of G


Astronomical Number of possible alignments! Tools for multiple sequence alignment ... `True' alignment known by information about structure or evolution. ... – PowerPoint PPT presentation

Number of Views:134
Avg rating:3.0/5.0
Slides: 90
Provided by: publ153


Transcript and Presenter's Notes

Title: Bioinformatics Methods Course Multiple Sequence Alignment Burkhard Morgenstern University of G

Bioinformatics Methods CourseMultiple Sequence
AlignmentBurkhard Morgenstern University of
GöttingenInstitute of Microbiology and Genetics
Department of BioinformaticsGöttingen,
October/November 2006
Tools for multiple sequence alignment
  • T Y I M R E A Q Y E
  • T C I V M R E A Y E

Tools for multiple sequence alignment
  • T Y I - M R E A Q Y E
  • T C I V M R E A - Y E

Tools for multiple sequence alignment
  • T Y I M R E A Q Y E
  • T C I V M R E A Y E
  • Y I M Q E V Q Q E
  • Y I A M R E Q Y E

Tools for multiple sequence alignment
  • T Y I - M R E A Q Y E
  • T C I V M R E A - Y E
  • Y - I - M Q E V Q Q E
  • Y I A M R E - Q Y E

Tools for multiple sequence alignment
  • T Y I - M R E A Q Y E
  • T C I V M R E A - Y E
  • - Y I - M Q E V Q Q E
  • Y I A M R E - Q Y E
  • Astronomical Number of possible alignments!

Tools for multiple sequence alignment
  • T Y I - M R E A Q Y E
  • T C I V - M R E A Y E
  • - Y I - M Q E V Q Q E
  • Y I A M R E - Q Y E
  • Astronomical Number of possible alignments!

Tools for multiple sequence alignment
  • T Y I - M R E A Q Y E
  • T C I V M R E A - Y E
  • - Y I - M Q E V Q Q E
  • Y I A M R E - Q Y E
  • Which one is the best ???

Tools for multiple sequence alignment
  • Questions in development of alignment programs
  • (1) What is a good alignment?
  • ? objective function (score)
  • (2) How to find a good alignment?
  • ? optimization algorithm
  • First question far more important !

Tools for multiple sequence alignment
  • Before defining an objective function (scoring
  • What is a biologically good alignment ??

Tools for multiple sequence alignment
  • Criteria for alignment quality
  • 3D-Structure align residues at corresponding
    positions in 3D structure of protein!
  • Evolution align residues with common ancestors!

Tools for multiple sequence alignment
  • T Y I - M R E A Q Y E
  • T C I V - M R E A Y E
  • - Y I - M Q E V Q Q E
  • - Y I A M R E - Q Y E
  • Alignment hypothesis about sequence evolution
  • Search for most plausible hypothesis!

Tools for multiple sequence alignment
  • Compute for amino acids a and b
  • Probability pa,b of substitution
  • a ? b (or b ? a),
  • Frequency qa of a
  • Define
  • s(a,b) log (pa,b / qa qb)

Tools for multiple sequence alignment
(No Transcript)
Tools for multiple sequence alignment
  • Traditional objective functions
  • Define Score of alignments as
  • Sum of individual similarity scores s(a,b)
  • Gap penalty g for each gap in alignment
  • Needleman-Wunsch scoring system (1970) for
    pairwise alignment ( alignment of two sequences)

  • T Y W I V
  • T - - L V
  • Example
  • Score s(T,T) s(I,L) s (V,V) 2 g

  • T Y W I V
  • T - - L V
  • Idea alignment with optimal (maximal) score
    probably biologically meaningful.
  • Dynamic programming algorithm finds optimal
    alignment for two sequences efficiently
    (Needleman and Wunsch, 1970).

Tools for multiple sequence alignment
  • Traditional Objective functions can be
    generalized to multiple alignment (e.g.
    sum-of-pair score, tree alignment)
  • Needleman-Wunsch algorithm can also be
    generalized to find optimal multiple alignment,
  • Very time and memory consuming!
  • -gt Heuristic algorithm needed, i.e. fast but
    sub-optimal solution

Tools for multiple sequence alignment
  • Most commonly used heuristic for multiple
  • Progressive alignment
  • (mid 1980s)

Progressive Alignment

Progressive Alignment
  • Guide tree

Progressive Alignment
  • Profile alignment, once a gap - always a gap

Progressive Alignment
  • Profile alignment, once a gap - always a gap

Progressive Alignment
  • Profile alignment, once a gap - always a gap

Progressive Alignment
  • Profile alignment, once a gap - always a gap

  • Most important software program
  • J. Thompson, T. Gibson, D. Higgins (1994),
    CLUSTAL W improving the sensitivity of
    progressive multiple sequence alignment Nuc.
    Acids. Res. 22, 4673 - 4680
  • ( 20.000 citations in the literature)

Tools for multiple sequence alignment
  • Problems with traditional approach
  • Results depend on gap penalty
  • Heuristic guide tree determines alignment
  • alignment used for phylogeny reconstruction
  • Algorithm produces global alignments.

Tools for multiple sequence alignment
  • Problems with traditional approach
  • But
  • Many sequence families share only local
  • E.g. sequences share one conserved motif

Local sequence alignment

Find common motif in sequences ignore the rest
Local sequence alignment

Find common motif in sequences ignore the rest
Local sequence alignment

Find common motif in sequences ignore the rest
Local alignment
Gibbs Motive Sampler
Local multiple alignment without gaps C.E.
Lawrence et al. (1993) Detecting subtle sequence
signals a Gibbs Sampling Strategy for Multiple
Alignment Science, 262, 208 - 214
Traditional alignment approaches Either global
or local methods!
New question sequence families with multiple
local similarities

Neither local nor global methods appliccable
New question sequence families with multiple
local similarities

Alignment possible if order conserved
The DIALIGN approach
  • Morgenstern, Dress, Werner (1996),
  • PNAS 93, 12098-12103
  • Combination of global and local methods
  • Assemble multiple alignment from
  • gap-free local pair-wise alignments
  • (,,fragments)

The DIALIGN approach
  • atctaatagttaaactcccccgtgcttag
  • cagtgcgtgtattactaacggttcaatcgcg
  • caaagagtatcacccctgaattgaataa

The DIALIGN approach
  • atctaatagttaaactcccccgtgcttag
  • cagtgcgtgtattactaacggttcaatcgcg
  • caaagagtatcacccctgaattgaataa

The DIALIGN approach
  • atctaatagttaaactcccccgtgcttag
  • cagtgcgtgtattactaacggttcaatcgcg
  • caaagagtatcacccctgaattgaataa

The DIALIGN approach
  • atctaatagttaaactcccccgtgcttag
  • cagtgcgtgtattactaacggttcaatcgcg
  • caaagagtatcacccctgaattgaataa

The DIALIGN approach
  • atctaatagttaaactcccccgtgcttag
  • cagtgcgtgtattactaacggttcaatcgcg
  • caaagagtatcacccctgaattgaataa

The DIALIGN approach
  • atctaatagttaaactcccccgtgcttag
  • cagtgcgtgtattactaacggttcaatcgcg
  • caaagagtatcacccctgaattgaataa

The DIALIGN approach
  • atc------taatagttaaactcccccgtgcttag
  • cagtgcgtgtattactaacggttcaatcgcg
  • caaagagtatcacccctgaattgaataa

The DIALIGN approach
  • atc------taatagttaaactcccccgtgcttag
  • cagtgcgtgtattactaacggttcaatcgcg
  • caaa--gagtatcacccctgaattgaataa

The DIALIGN approach
  • atc------taatagttaaactcccccgtgcttag
  • cagtgcgtgtattactaacggttcaatcgcg
  • caaa--gagtatcacc----------cctgaattgaataa

The DIALIGN approach
  • atc------taatagttaaactcccccgtgc-ttag
  • cagtgcgtgtattactaac----------gg-ttcaatcgcg
  • caaa--gagtatcacc----------cctgaattgaataa

The DIALIGN approach
  • atc------taatagttaaactcccccgtgc-ttag
  • cagtgcgtgtattactaac----------gg-ttcaatcgcg
  • caaa--gagtatcacc----------cctgaattgaataa

The DIALIGN approach
  • atc------TAATAGTTAaactccccCGTGC-TTag
  • cagtgcGTGTATTACTAAc----------GG-TTCAATcgcg
  • caaa--GAGTATCAcc----------CCTGaaTTGAATaa

The DIALIGN approach
  • Multiple alignment
  • atctaatagttaaactcccccgtgcttag
  • cagtgcgtgtattactaacggttcaatcgcg
  • caaagagtatcacccctgaattgaataa

The DIALIGN approach
  • Multiple alignment
  • atctaatagttaaactcccccgtgcttag
  • cagtgcgtgtattactaacggttcaatcgcg
  • caaccctgaattgaagagtatcacataa
  • (1) Calculate all optimal pair-wise alignments

The DIALIGN approach
  • Multiple alignment
  • atctaatagttaaactcccccgtgcttag
  • cagtgcgtgtattactaacggttcaatcgcg
  • caaagagtatcacccctgaattgaataa
  • (1) Calculate all optimal pair-wise alignments

The DIALIGN approach
  • Multiple alignment
  • atctaatagttaaactcccccgtgcttag
  • cagtgcgtgtattactaacggttcaatcgcg
  • caaagagtatcacccctgaattgaataa
  • (1) Calculate all optimal pair-wise alignments

The DIALIGN approach
  • Fragments from optimal pair-wise alignments
  • might be inconsistent

The DIALIGN approach
  • atctaatagttaaactcccccgtgcttag
  • cagtgcgtgtattactaacggttcaatcgcg
  • caaagagtatcacccctgaattgaataa

The DIALIGN approach
  • atctaatagttaaactcccccgtgcttag
  • cagtgcgtgtattactaacggttcaatcgcg
  • caaagagtatcacccctgaattgaataa

The DIALIGN approach
  • atctaatagttaaactcccccgtgcttag
  • cagtgcgtgtattactaacggttcaatcgcg
  • caaagagtatcacccctgaattgaataa

The DIALIGN approach
  • atctaatagttaaactcccccgtgcttag
  • cagtgcgtgtattactaacggttcaatcgcg
  • caaa--gagtatcacccctgaattgaataa

The DIALIGN approach
  • atc------taatagttaaactcccccgtgcttag
  • cagtgcgtgtattactaacggttcaatcgcg
  • caaa--gagtatcacccctgaattgaataa

The DIALIGN approach
  • atctaatagttaaactcccccgtgcttag
  • cagtgcgtgtattactaacggttcaatcgcg
  • caaagagtatcacccctgaattgaataa

The DIALIGN approach

  • Score of alignment
  • Define weight score for fragments based on
    probability of random occurrence
  • Score of alignment sum of weight scores of
  • Goal find consistent set of fragments with
    maximum total weight

The DIALIGN approach

  • Advantages of segment-based approach
  • Program can produce global and local alignments!
  • Sequence families alignable that cannot be
    aligned with standard methods


  • C. Notredame, D. Higgins, J. Heringa (2000),
    T-Coffee A novel algorithm for multiple sequence
    alignment, J. Mol. Biol.





  • Less sensitive to spurious pairwise similarities
  • Can handle local homologies better than CLUSTAL


  • Idea
  • Build library of pairwise alignments
  • Alignment from seq i, j and seq j, k supports
    alignmetn from seq i, k.

Evaluation of multi-alignment methods

  • Alignment evaluation by comparison to trusted
    benchmark alignments.
  • True alignment known by information about
    structure or evolution.

Evaluation of multi-alignment methods
  • For protein alignment
  • M. McClure et al. (1994)
  • 4 protein families, known functional sites
  • J. Thompson et al. (1999)
  • Benchmark data base, 130 known 3D structures
  • T. Lassmann E. Sonnhammer (2002)
    BAliBASE simulated evolution (ROSE)

Evaluation of multi-alignment methods


Evaluation of multi-alignment methods

1aboA 1 .NLFVALYDfvasgdntlsitkGEKLRVLgynhn
..............gE 1ycsB 1
1pht 1 gYQYRALYDykkereedidlhlGDILTVNkgs
lvalgfsdgqearpeeiG 1ihvA 1
1vie 1 .drvrkksga.........awqGQIVGWYctn
lt.............peG 1aboA 36
WCEAQt..kngqGWVPSNYITPVN...... 1ycsB 39
WWWARl..ndkeGYVPRNLLGLYP...... 1pht 51
WLNGYnettgerGDFPGTYVEYIGrkkisp 1ihvA 27
AVVIQd..nsdiKVVPRRKAKIIRd..... 1vie 28
YAVESeahpgsvQIYPVAALERIN...... Key alpha
helix RED beta strand GREEN core blocks
BAliBASE Reference alignments

Result DIALIGN best method for distantly related
sequences, T-Coffee best for globally related

Evaluation of multi-alignment methods
  • BAliBASE 5 categories of benchmark sequences
    (globally related, internal gaps, end gaps)
    on globally related sequences, DIALIGN superior
    for local similarities

Evaluation of multi-alignment methods
  • Conclusion no single best multi alignment
  • Advice try different methods!

Anchored sequence alignment
  • Idea semi-automatic alignment
  • use expert knowledge to define constraints
    instead of fully automated alignment
  • Define parts of the sequences where biologically
    correct alignment is known as anchor points,
    align rest of the sequences automatically.

Anchored sequence alignment

Anchored sequence alignment
  • Anchor points in multiple alignment

Anchored sequence alignment
  • Anchor points in multiple alignment

Anchored sequence alignment
  • -------NLF V-ALYDFVAS GD-------- NTLSITKGEk
  • Anchored multiple alignment

Algorithmic questions
  • Goal
  • Find optimal alignment (consistent set of
    fragments) under costraints given by
    user-specified anchor points!

Algorithmic questions
  • Additional input file with anchor points
  • 1 3 215 231 5 4.5
  • 2 3 34 78 23 1.23
  • 1 4 317 402 8 8.5

Algorithmic questions

Algorithmic questions
  • Additional input file with anchor points
  • 1 3 215 231 5 4.5
  • 2 3 34 78 23 1.23
  • 1 4 317 402 8 8.5

Algorithmic questions
  • Additional input file with anchor points
  • 1 3 215 231 5 4.5
  • 2 3 34 78 23 1.23
  • 1 4 317 402 8 8.5
  • Sequences

Algorithmic questions
  • Additional input file with anchor points
  • 1 3 215 231 5 4.5
  • 2 3 34 78 23 1.23
  • 1 4 317 402 8 8.5
  • Sequences start positions

Algorithmic questions
  • Additional input file with anchor points
  • 1 3 215 231 5 4.5
  • 2 3 34 78 23 1.23
  • 1 4 317 402 8 8.5
  • Sequences start positions length

Algorithmic questions
  • Additional input file with anchor points
  • 1 3 215 231 5 4.5
  • 2 3 34 78 23 1.23
  • 1 4 317 402 8 8.5
  • Sequences start positions length
Write a Comment
User Comments (0)