Multiple Sequence Alignment - PowerPoint PPT Presentation

About This Presentation
Title:

Multiple Sequence Alignment

Description:

Multiple Sequence Alignment An alignment of heads Sequence Alignment A way of arranging the primary sequences of DNA, RNA and amino acid to identify the regions of ... – PowerPoint PPT presentation

Number of Views:612
Avg rating:3.0/5.0
Slides: 13
Provided by: Ian2158
Category:

less

Transcript and Presenter's Notes

Title: Multiple Sequence Alignment


1
Multiple Sequence Alignment
2
An alignment of heads
3
Sequence Alignment
  • A way of arranging the primary sequences of DNA,
    RNA and amino acid to identify the regions of
    similarity that may be a consequence of
    functional, structural or evolutionary
    relationship between the sequences.

4
Goals
  • To establish an hypothesis of positional homology
    between bases/amino acids.
  • To generate a concise, information-rich summary
    of sequence data.
  • Sometimes used to illustrate the dissimilarity
    between a group of sequences.
  • Alignments can be treated as models that can be
    used to test hypotheses.

5
Sequence Alignment
  • Aligned sequences of nucleotide or amino acid
    residues are typically represented as rows within
    a matrix.
  • Gaps (symbol -) are inserted between the
    residues so that residues with identical or
    similar characters are aligned.

GGGAATCTAGGACTATACCGGATCTA GGGAATCTA--ACTATA--GGAT
CTA GGG--TCTAGGACTATACCGGAT--A
Taxon A Taxon B Taxon C
6
Alignment can be easy or difficult
Easy
Difficult due to insertions or deletions
(indels)
7
(No Transcript)
8
Protein Alignment may be guided by Tertiary
Structure Interactions
Homo sapiens DjlA protein
Escherichia coli DjlA protein
9
Multiple Sequence Alignment- Approaches
  • 3 main approaches of alignment
  • Manual
  • Automatic
  • Combined

10
Manual Alignment
  • Might be carried out because
  • Alignment is easy.
  • There is some extraneous information
    (structural).
  • Automated alignment methods have encountered the
    local minimum problem.
  • An automated alignment method can be improved.

11
Automatic AlignmentProgressive Approach
  • Devised by Feng and Doolittle in 1987.
  • Essentially a heuristic method and as such is not
    guaranteed to find the optimal alignment.
  • Requires n-1n-2n-3...n-n1 pairwise alignments
    as a starting point.
  • Most successful implementation is CLUSTAL.

12
Overview of ClustalW Procedure
ClustalW
Hbb_Human 1 -
Hbb_Horse 2 .17 -
Hba_Human 3 .59 .60 -
Quick pairwise alignment calculate distance
matrix
Hba_Horse 4 .59 .59 .13 -
Myg_Whale 5 .77 .77 .75 .75 -
Hbb_Human
4
2
3
Hbb_Horse
Hba_Human
Neighbor-joining tree (guide tree)
1
Hba_Horse
Myg_Whale
alpha-helices
1 PEEKSAVTALWGKVN--VDEVGG
4
2
3
Progressive alignment following guide tree
2 GEEKAAVLALWDKVN--EEEVGG
3 PADKTNVKAAWGKVGAHAGEYGA
1
4 AADKTNVKAAWSKVGGHAGEYGA
5 EHEWQLVLHVWAKVEADVAGHGQ
Write a Comment
User Comments (0)
About PowerShow.com