Pairwise sequence alignment (practice) - PowerPoint PPT Presentation

About This Presentation
Title:

Pairwise sequence alignment (practice)

Description:

Pairwise sequence alignment (practice) * * Manual Work: Write down the amino acid sequences derived from all six possible reading frames of: seq1 ACTGTCGC Open the ... – PowerPoint PPT presentation

Number of Views:350
Avg rating:3.0/5.0
Slides: 17
Provided by: bio1171
Learn more at: http://nsmn1.uh.edu
Category:

less

Transcript and Presenter's Notes

Title: Pairwise sequence alignment (practice)


1
Pairwise sequence alignment (practice)
2
Manual Work Write down the amino acid sequences
derived from all six possible reading frames
of gtseq1 ACTGTCGC
3
  • Open the following website
  • http//biotools.umassmed.edu/cgi-bin/biobin/transe
    q

Choose all frames
Remove X
4
Translate all possible reading frames of the
following sequence
  • TATGTCTCTCACCAACAAGAACGTCGTTTTCGTGGCCGGTCTGGGCGGCA
    TTGGCCTGGAC
  • ACCAGCCGGGAGTTGGTCAAGCGTAATCTGAAGAACCTGGTCATCCTGGA
    TCGCATTGAC
  • AATCCGGCTGCCATTGCCGAACTGAAGGCAATCAATCCCAAGGTGACCAT
    CACCTTCTAT
  • CCCTACGATGTGACTGTGCCCGTCGCTGAGACCACCAAGCTCCTGAAGAC
    CATCTTTGCC
  • CAGGTGAAGACAATCGATGTCCTGATCAACGGTGCTGGCATCCTGGACGA
    TCATCAGATC
  • GAGCGCACCATTGCCGTTAACTACACGGGCCTGGTCAACACCACCACAGC
    CATTCTGGAC
  • TTCTGGGACAAGCGCAAGGGCGGCCCAGGCGGCATCATTTGCAACATTGG
    CTCCGTCACC
  • GGTTTCAATGCCATCTACCAGGTGCCCGTTTACTCCGGCTCCAAGGCGGC
    GGTGGTTAAC
  • TTTACCTCCTCCCTGGCGAAACTGGCTCCCATTACTGGTGTCACTGCTTA
    CACTGTCAAT
  • CCTGGCATCACCAGGACCACTCTGGTCCACAAATTCAACTCGTGGCTGGA
    TGTGGAGCCC
  • CGTGTGGCGGAGAAGCTGCTCGAGCATCCCACCCAGACCTCTCAGCAGTG
    CGCCGAGAAC
  • TTTGTGAAGGCCATTGAGCTGAACAAGAACGGTGCCATCTGGAAGTTGGA
    TTTGGGCACC
  • TTGGAGCCCATCACATGGACCCAGCACTGGGACTCGGGCATCTAA

Which reading frame(s) is(are) likely to be the
true reading frame(s)?
5
(No Transcript)
6
DOT-PLOT Give the coordinates of the boxes to
be filled?
Window size 5 Stringency 5
Window size 5 Stringency 2
7
Nucleic Acid Dot Plots (http//www.vivo.colostate.
edu/molkit/dnadot/)
Copy DNA sequences
Compare Horse (NM_001164018) and Chicken
(NM_001081704) hemoglobin
Window size must be an odd number
Number of mismatches allowed
8
(No Transcript)
9
Use the Dotplot to compare chicken ovomucoid
(NM_001112662) to itself
GCACCGGCAGCCGCCTGCAGAGCCGGGCAGTACCTCACCATGGCCATGGC
AGGCGTCTTCGTGCTGTTCT CTTTCGTGCTTTGTGGCTTCCTCCCAGAT
GCTGCCTTTGGGGCTGAGGTGGACTGCAGTAGGTTTCCCAA CGCTACAG
ACAAGGAAGGCAAAGATGTATTGGTTTGCAACAAGGACCTCCGCCCCATC
TGTGGTACCGAT GGAGTCACTTACACCAACGATTGCTTGCTGTGTGCCT
ACAGCATAGAATTTGGAACCAATATCAGCAAAG AGCACGATGGAGAATG
CAAGGAAACTGTTCCTATGAACTGCAGTAGTTATGCCAACACGACAAGCG
AGGA CGGAAAAGTGATGGTCCTCTGCAACAGGGCCTTCAACCCCGTCTG
TGGTACTGATGGAGTCACCTACGAC AATGAGTGTCTGCTGTGTGCCCAC
AAAGTAGAGCAGGGGGCCAGCGTTGACAAGAGGCATGATGGTGGAT GTA
GGAAGGAACTTGCTGCTGTTGACTGCAGCGAGTACCCTAAGCCTGACTGC
ACGGCAGAAGACAGACC TCTCTGTGGCTCCGACAACAAAACATATGGCA
ACAAGTGCAACTTCTGCAATGCAGTCGTGGAAAGCAAC GGGACTCTCAC
TTTAAGCCATTTTGGAAAATGCTGAATATCAGAGCTGAGAGAATTCACCA
CAGGATCCC CACTGGCGAATCCCAGCGAGAGGTCTCACCTCGGTTCATC
TCGCACTCTGGGGAGCTCAGCTCACTCCCG ATTTTCTTTCTCAATAAAC
TAAATCAGCAACAAAAAAAAAA
10
What do these parallel lines represent?
11
LALIGN - finds multiple matching subsegments in
two sequences
Part of the FASTA package of sequence analysis
program.
Lalign - compares two protein or DNA sequences
for local or global similarity and shows the
local sequence alignments.
http//www.ch.embnet.org/software/LALIGN_form.html
12
Choose method
default matrix
Set scoring matrix and gap penalties
Paste your sequence
13
Open http//www.ch.embnet.org/software/LALIGN_for
m.html
  • Use the sequences below and perform a global
    alignment with 5 Opening gap penalty and 0
    Extending gap penalty.
  • gtseq1
  • GCGACTGTTCCTATGAACTGCAGTAGTTATGCCAACACGACAAGCGAGGA
    CGGAAAAGTGAGTCTGTGGTACTGATGGAGTCACCTACGACGCGAGGACG
    CCAGGTG
  • gtseq2
  • GCGAGGACGGAAAAGTG

14
GLOBAL DOESNT ALWAYS WORK.
GLOBAL
15
SOLUTION LOCAL
16
Write down the amino acid sequences derived from
all six possible reading frames
of gtseq1 ACTGTCGC gtseqRC GCGACAGT Forward gt_
1 TV gt_2 LS gt_3 CR Reverse gt_1 AT gt_2 RQ
gt_3 DS
Write a Comment
User Comments (0)
About PowerShow.com