5,000+ Sequence Alignment PPTs View free & download

GLOBAL PAIRWISE ALIGNMENT GLOBAL ALIGNMENT OF: 2 NUCLEOTIDE SEQUENCES OR 2 AMINO-ACID SEQUENCES PowerPoint PPT Presentation

GLOBAL PAIRWISE ALIGNMENT GLOBAL ALIGNMENT OF: 2 NUCLEOTIDE SEQUENCES OR 2 AMINO-ACID SEQUENCES - GLOBAL PAIRWISE ALIGNMENT GLOBAL ALIGNMENT OF: 2 NUCLEOTIDE SEQUENCES OR 2 AMINO-ACID SEQUENCES * To derive a mutational probability matrix for a protein sequence ...

GLOBAL PAIRWISE ALIGNMENT GLOBAL ALIGNMENT OF: 2 NUCLEOTIDE SEQUENCES OR 2 AMINO-ACID SEQUENCES * To derive a mutational probability matrix for a protein sequence ...

| PowerPoint PPT presentation | free to download

Sequencing, Sequence Alignment PowerPoint PPT Presentation

Sequencing, Sequence Alignment - Sequencing, Sequence Alignment & Software Lushan Wang, Shandong University

Sequencing, Sequence Alignment & Software Lushan Wang, Shandong University

| PowerPoint PPT presentation | free to view

CrossWA: A new approach of combining pairwise and three-sequence alignments to improve the accuracy for highly divergent sequence alignment PowerPoint PPT Presentation

CrossWA: A new approach of combining pairwise and three-sequence alignments to improve the accuracy for highly divergent sequence alignment - CrossWA: A new approach of combining pairwise and three-sequence alignments to improve the accuracy for highly divergent sequence alignment Che-Lun Hung, Chun-Yuan ...

CrossWA: A new approach of combining pairwise and three-sequence alignments to improve the accuracy for highly divergent sequence alignment Che-Lun Hung, Chun-Yuan ...

| PowerPoint PPT presentation | free to view

Statistical Significance for Local Sequence Alignments Multiple Sequence Alignments Profilebased seq PowerPoint PPT Presentation

Statistical Significance for Local Sequence Alignments Multiple Sequence Alignments Profilebased seq - ... methods. align two sequences ... the most closely related sequences are aligned first ... Pattern that can be used to scan databases for its occurrence ...

... methods. align two sequences ... the most closely related sequences are aligned first ... Pattern that can be used to scan databases for its occurrence ...

| PowerPoint PPT presentation | free to view

CrossWA: A new approach of combining pairwise and three-sequence alignments to improve the accuracy for highly divergent sequence alignment - CrossWA: A new approach of combining pairwise and three-sequence alignments to improve the accuracy for highly divergent sequence alignment Che-Lun Hung, Chun-Yuan ...

CrossWA: A new approach of combining pairwise and three-sequence alignments to improve the accuracy for highly divergent sequence alignment Che-Lun Hung, Chun-Yuan ...

| PowerPoint PPT presentation | free to view

Sequencing and Sequence Alignment PowerPoint PPT Presentation

Sequencing and Sequence Alignment - Sequencing and Sequence Alignment CIS 667 Bioinformatics Spring 2004 Protein Sequencing Before DNA sequencing, protein sequencing was common Sanger won a Nobel prize ...

Sequencing and Sequence Alignment CIS 667 Bioinformatics Spring 2004 Protein Sequencing Before DNA sequencing, protein sequencing was common Sanger won a Nobel prize ...

| PowerPoint PPT presentation | free to view

Local Multiple Sequence Alignment Sequence File Formats PowerPoint PPT Presentation

Local Multiple Sequence Alignment Sequence File Formats - Just like with pairwise alignments, we may not be ... SKH SKH HELA MYSTERY PUTATIVE PROTEIN KINASE ... SVK HSVK HERPES SIMPLEX VIRUS PUTATIVE PROTEIN KINASE ...

Just like with pairwise alignments, we may not be ... SKH SKH HELA MYSTERY PUTATIVE PROTEIN KINASE ... SVK HSVK HERPES SIMPLEX VIRUS PUTATIVE PROTEIN KINASE ...

| PowerPoint PPT presentation | free to view

PAIRWISE ALIGNMENT ALIGNMENT OF TWO NUCLEOTIDE OR TWO AMINOACID SEQUENCES PowerPoint PPT Presentation

PAIRWISE ALIGNMENT ALIGNMENT OF TWO NUCLEOTIDE OR TWO AMINOACID SEQUENCES - The units in a scoring matrix may be the nucleotides in DNA or RNA sequences, ... The number of possible alignments may be astronomical. ...

The units in a scoring matrix may be the nucleotides in DNA or RNA sequences, ... The number of possible alignments may be astronomical. ...

| PowerPoint PPT presentation | free to view

MCALIGN: Stochastic Alignment of Non-coding DNA Sequences based on an Evolutionary Model of Sequence Evolution PowerPoint PPT Presentation

MCALIGN: Stochastic Alignment of Non-coding DNA Sequences based on an Evolutionary Model of Sequence Evolution - MCALIGN: Stochastic Alignment of Non-coding DNA Sequences based on an ... Where indels almost occur in multiples of three bp and rarely cross codon boundaries ...

MCALIGN: Stochastic Alignment of Non-coding DNA Sequences based on an ... Where indels almost occur in multiples of three bp and rarely cross codon boundaries ...

| PowerPoint PPT presentation | free to view

Sequence Alignment PowerPoint PPT Presentation

Sequence Alignment - sequence alignment aggctatcacctgacctccaggccgatgccc tagctatcacgaccgcggtcgatttgcccgac-aggctatcacctgacctccaggccga--tgccc---tag-ctatcac--gaccgc--ggtcgatttgcccgac

sequence alignment aggctatcacctgacctccaggccgatgccc tagctatcacgaccgcggtcgatttgcccgac-aggctatcacctgacctccaggccga--tgccc---tag-ctatcac--gaccgc--ggtcgatttgcccgac

| PowerPoint PPT presentation | free to download

Sequence Alignment - Sequence Alignment.

Sequence Alignment.

| PowerPoint PPT presentation | free to download

Sequence Alignment - Sequence Alignment

Sequence Alignment

| PowerPoint PPT presentation | free to download

Sequence Alignment - Sequence Alignment

Sequence Alignment

| PowerPoint PPT presentation | free to view

Pairwise Sequence Alignment - Pairwise Sequence Alignment *

Pairwise Sequence Alignment *

| PowerPoint PPT presentation | free to download

Sequence Alignment I PowerPoint PPT Presentation

Sequence Alignment I - Assess ancestry among homologs (sequences with common ancestory) to help in gene ... AA--GATA ... AA--GATA. Alignment scores would be -3, -1, 1, respectively; ...

Assess ancestry among homologs (sequences with common ancestory) to help in gene ... AA--GATA ... AA--GATA. Alignment scores would be -3, -1, 1, respectively; ...

| PowerPoint PPT presentation | free to download

Sequences Alignment Statistics PowerPoint PPT Presentation

Sequences Alignment Statistics - Sequences Alignment Statistics Ka-Lok Ng Asia University

Sequences Alignment Statistics Ka-Lok Ng Asia University

| PowerPoint PPT presentation | free to view

Sequence Alignment II PowerPoint PPT Presentation

Sequence Alignment II - Large number of sequences to search your query sequence against. ... Blast of human beta globin protein against zebra fish. Sample BLAST output (cont'd) ...

Large number of sequences to search your query sequence against. ... Blast of human beta globin protein against zebra fish. Sample BLAST output (cont'd) ...

| PowerPoint PPT presentation | free to download

Multiple Sequence Alignment PowerPoint PPT Presentation

Multiple Sequence Alignment - Multiple Sequence Alignment An alignment of heads Sequence Alignment A way of arranging the primary sequences of DNA, RNA and amino acid to identify the regions of ...

Multiple Sequence Alignment An alignment of heads Sequence Alignment A way of arranging the primary sequences of DNA, RNA and amino acid to identify the regions of ...

| PowerPoint PPT presentation | free to download

Sequence Alignment and Phylogeny PowerPoint PPT Presentation

Sequence Alignment and Phylogeny - Sequence Alignment and Phylogeny B I O I N F O R M A T I C S | | | | | | | B I O L O G Y - M A T H - S Dr Peter Smooker, peter.smooker@rmit.edu.au

Sequence Alignment and Phylogeny B I O I N F O R M A T I C S | | | | | | | B I O L O G Y - M A T H - S Dr Peter Smooker, peter.smooker@rmit.edu.au

| PowerPoint PPT presentation | free to view

Multiple Sequence Alignment - Global algorithms are often not effective for highly diverged sequences and do ... The MACAW and SeqVu program for Macintosh and GeneDoc and DCSE for PCs are free ...

Global algorithms are often not effective for highly diverged sequences and do ... The MACAW and SeqVu program for Macintosh and GeneDoc and DCSE for PCs are free ...

| PowerPoint PPT presentation | free to view

Multiple Sequence Alignment - Multiple Sequence Alignment An Inexact Science

Multiple Sequence Alignment An Inexact Science

| PowerPoint PPT presentation | free to download

Sequence Alignment - Sequence Alignment

Sequence Alignment

| PowerPoint PPT presentation | free to download

Pairwise sequence alignment - Pairwise sequence alignment. Urmila Kulkarni-Kale. Bioinformatics Centre, ... Two main Heuristic Local Alignment Algorithms: BLAST and FASTA. ...

Pairwise sequence alignment. Urmila Kulkarni-Kale. Bioinformatics Centre, ... Two main Heuristic Local Alignment Algorithms: BLAST and FASTA. ...

| PowerPoint PPT presentation | free to download

Pairwise sequence alignment (practice) PowerPoint PPT Presentation

Pairwise sequence alignment (practice) - Pairwise sequence alignment (practice) * * Manual Work: Write down the amino acid sequences derived from all six possible reading frames of: seq1 ACTGTCGC Open the ...

Pairwise sequence alignment (practice) * * Manual Work: Write down the amino acid sequences derived from all six possible reading frames of: seq1 ACTGTCGC Open the ...

| PowerPoint PPT presentation | free to download

GA for Sequence Alignment PowerPoint PPT Presentation

GA for Sequence Alignment - GA for Sequence Alignment Pair-wise alignment Multiple string alignment Pairwise Sequence Alignment VNRLQQNIVSLEVDHKVANYKP VNRLQQSIVSLRDAFNDGELD HRVLNYKP Solving by a ...

GA for Sequence Alignment Pair-wise alignment Multiple string alignment Pairwise Sequence Alignment VNRLQQNIVSLEVDHKVANYKP VNRLQQSIVSLRDAFNDGELD HRVLNYKP Solving by a ...

| PowerPoint PPT presentation | free to view

Sequence Alignment - Large number of sequences to search your query sequence against. ... Jukes-Cantor model. Transitions vs transversions. Kimura's 2-parameter model ...

Large number of sequences to search your query sequence against. ... Jukes-Cantor model. Transitions vs transversions. Kimura's 2-parameter model ...

| PowerPoint PPT presentation | free to download

Multiple Sequence Alignment - ... interfaces Conserved residue analysis Comparison of sequence-based methods Central role of multiple alignments Bioinformatique Multiple Sequence Alignment ...

... interfaces Conserved residue analysis Comparison of sequence-based methods Central role of multiple alignments Bioinformatique Multiple Sequence Alignment ...

| PowerPoint PPT presentation | free to view

Sequence Alignments and Database Searches PowerPoint PPT Presentation

Sequence Alignments and Database Searches - Introduction to Bioinformatics Sequence Alignments and Database Searches

Introduction to Bioinformatics Sequence Alignments and Database Searches

| PowerPoint PPT presentation | free to download

Sequence Alignments and Database Searching PowerPoint PPT Presentation

Sequence Alignments and Database Searching - Sequence Alignments and Database Searching 08/20/07

Sequence Alignments and Database Searching 08/20/07

| PowerPoint PPT presentation | free to download

Multiple Sequence Alignment - Construct multiple alignments using pair-wise alignment relative to a fixed sequence ... (Si, Sj) is the optimal score of a pair-wise alignment between Si and Sj ...

Construct multiple alignments using pair-wise alignment relative to a fixed sequence ... (Si, Sj) is the optimal score of a pair-wise alignment between Si and Sj ...

| PowerPoint PPT presentation | free to download

Automatic and manual sequence alignment PowerPoint PPT Presentation

Automatic and manual sequence alignment - Automatic and manual sequence alignment Inferring phylogenetic trees Mining web-based databases Estimating rates of molecular evolution Testing evolutionary hypotheses

Automatic and manual sequence alignment Inferring phylogenetic trees Mining web-based databases Estimating rates of molecular evolution Testing evolutionary hypotheses

| PowerPoint PPT presentation | free to download

Sequence Alignment - Smith-Waterman, BLAST. Number of sequences. Pairwise alignment - only two sequences compared. Dotmatrix, Needleman-Wunsch, Smith-Waterman, BLAST ...

Smith-Waterman, BLAST. Number of sequences. Pairwise alignment - only two sequences compared. Dotmatrix, Needleman-Wunsch, Smith-Waterman, BLAST ...

| PowerPoint PPT presentation | free to view

Multiple sequence alignment - Multiple nucleotide or amino sequence alignment techniques are usually performed ... XX and YY specify the exact positions to begin (XX) and end (YY) the realignment. ...

Multiple nucleotide or amino sequence alignment techniques are usually performed ... XX and YY specify the exact positions to begin (XX) and end (YY) the realignment. ...

| PowerPoint PPT presentation | free to download

Sequence Alignment - Sequence Alignment Exercise: Write a program that given two input sequence (in a single file in fasta format), and a choice of a general gap function and scoring ...

Sequence Alignment Exercise: Write a program that given two input sequence (in a single file in fasta format), and a choice of a general gap function and scoring ...

| PowerPoint PPT presentation | free to download

Sequence Alignment - Sequence Alignment. CS262 Lecture 3, ... an alignment is an assignment of gaps to positions ... the optimal path, Lh, entering column h-1, exiting column h ...

Sequence Alignment. CS262 Lecture 3, ... an alignment is an assignment of gaps to positions ... the optimal path, Lh, entering column h-1, exiting column h ...

| PowerPoint PPT presentation | free to view

Sequence Alignment - how to position two strings, with gaps, so as to maximize the ... FASTA Incarnations. FASTA compares sequence to another sequence or database (protein or DNA) ...

how to position two strings, with gaps, so as to maximize the ... FASTA Incarnations. FASTA compares sequence to another sequence or database (protein or DNA) ...

| PowerPoint PPT presentation | free to view

Sequence Alignment - Output: An 'alignment' (mapping one sequence onto the other, possibly with gaps) ... is the Genome Multimedia Site: ocelot.bio.brandeis.edu / pages/classes ...

Output: An 'alignment' (mapping one sequence onto the other, possibly with gaps) ... is the Genome Multimedia Site: ocelot.bio.brandeis.edu / pages/classes ...

| PowerPoint PPT presentation | free to download

Sequence Alignments PowerPoint PPT Presentation

Sequence Alignments - Alignment between two or more nucleotide or amino acid sequences ... Example: Bos taurus and porcine myoglobin mRNA sequences (sequences on course website) ...

Alignment between two or more nucleotide or amino acid sequences ... Example: Bos taurus and porcine myoglobin mRNA sequences (sequences on course website) ...

| PowerPoint PPT presentation | free to view

Pairwise Sequence Alignment - DP Algorithm Sketch. initialize first row and column of matrix ... Local Alignment DP Algorithm. initialization: first row and first column initialized with 0's ...

DP Algorithm Sketch. initialize first row and column of matrix ... Local Alignment DP Algorithm. initialization: first row and first column initialized with 0's ...

| PowerPoint PPT presentation | free to view

Sequence alignment algorithms PowerPoint PPT Presentation

Sequence alignment algorithms - Pic 1. Pic 2. Structure. function. Protein A is a constituent of muscle, skin, ... Pic 3. Real alignment. Scoring ... Pic 4. A substitution matrix ...

Pic 1. Pic 2. Structure. function. Protein A is a constituent of muscle, skin, ... Pic 3. Real alignment. Scoring ... Pic 4. A substitution matrix ...

| PowerPoint PPT presentation | free to view

Algorithms for Ultra-large Multiple Sequence Alignment and Phylogeny Estimation PowerPoint PPT Presentation

Algorithms for Ultra-large Multiple Sequence Alignment and Phylogeny Estimation - Algorithms for Ultra-large Multiple Sequence Alignment and Phylogeny Estimation Tandy Warnow Department of Computer Science The University of Texas at Austin

Algorithms for Ultra-large Multiple Sequence Alignment and Phylogeny Estimation Tandy Warnow Department of Computer Science The University of Texas at Austin

| PowerPoint PPT presentation | free to download

Sequence Alignment - S. B. Needleman ... max ( subproblem ( i 1, j ) , subproblem ( i, j 1 ) ); Memorizing ... gap x in sequence B } max { S[i, j y] w( y ); gap y in sequence ...

S. B. Needleman ... max ( subproblem ( i 1, j ) , subproblem ( i, j 1 ) ); Memorizing ... gap x in sequence B } max { S[i, j y] w( y ); gap y in sequence ...

| PowerPoint PPT presentation | free to view

Sequence Alignment - We can think of these sequences as strings of letters. DNA & RNA: alphabet of 4 letters ... Lemma: T(m,n) 2cmn. Time complexity is linear in size of the problem ...

We can think of these sequences as strings of letters. DNA & RNA: alphabet of 4 letters ... Lemma: T(m,n) 2cmn. Time complexity is linear in size of the problem ...

| PowerPoint PPT presentation | free to view

Sequence Alignment - Sequence Alignment * * * * * * * * * * * * * * * Alignment of pairs of sequence Local and global alignments Methods of alignments Dot matrix analysis Dynamic ...

Sequence Alignment * * * * * * * * * * * * * * * Alignment of pairs of sequence Local and global alignments Methods of alignments Dot matrix analysis Dynamic ...

| PowerPoint PPT presentation | free to view

Genomic Sequence Alignment PowerPoint PPT Presentation

Genomic Sequence Alignment - Genomic Sequence Alignment Overview Dynamic programming & the Needleman-Wunsch algorithm Local alignment BLAST Fast global alignment Multiple sequence alignment ...

Genomic Sequence Alignment Overview Dynamic programming & the Needleman-Wunsch algorithm Local alignment BLAST Fast global alignment Multiple sequence alignment ...

| PowerPoint PPT presentation | free to download

Sequence Alignment - an alignment is an assignment of ... We can think of these sequences as strings of letters. DNA & RNA: ... human, mouse, rat, fugu fish. 48. Local Alignment ...

an alignment is an assignment of ... We can think of these sequences as strings of letters. DNA & RNA: ... human, mouse, rat, fugu fish. 48. Local Alignment ...

| PowerPoint PPT presentation | free to view

Multiple Sequence Alignment - To generate a concise, information-rich summary of sequence data. ... More time than the universe has existed to align 20 sequences exhaustively. ...

To generate a concise, information-rich summary of sequence data. ... More time than the universe has existed to align 20 sequences exhaustively. ...

| PowerPoint PPT presentation | free to view

Multiple Sequence Alignment (II) PowerPoint PPT Presentation

Multiple Sequence Alignment (II) - Multiple Sequence Alignment (II) (Lecture for CS498-CXZ Algorithms in Bioinformatics) ... Dynamic programming for multi-sequence alignment gives an exact solution, but ...

Multiple Sequence Alignment (II) (Lecture for CS498-CXZ Algorithms in Bioinformatics) ... Dynamic programming for multi-sequence alignment gives an exact solution, but ...

| PowerPoint PPT presentation | free to download

Multiple Sequence Alignments PowerPoint PPT Presentation

Multiple Sequence Alignments - NFL/-S. N-YLS. NKYLS. N-F-S. N-FLS. Alignment ... Pairs of gaps score 0. Total up scores for each column ... Costs O(k2) to calculate each SP score ...

NFL/-S. N-YLS. NKYLS. N-F-S. N-FLS. Alignment ... Pairs of gaps score 0. Total up scores for each column ... Costs O(k2) to calculate each SP score ...

| PowerPoint PPT presentation | free to view

Comparing biological sequences (3): Database searching and Multiple alignment - Comparing biological sequences (3): Database searching and Multiple alignment

Comparing biological sequences (3): Database searching and Multiple alignment

| PowerPoint PPT presentation | free to download

Using Traveling Salesman Problem Algorithms to Determine Multiple Sequence Alignment Orders PowerPoint PPT Presentation

Using Traveling Salesman Problem Algorithms to Determine Multiple Sequence Alignment Orders - Title: Traveling Salesman Problem and Multiple Sequence Alignment Author: weiwei Last modified by: rwr Created Date: 1/22/2003 9:38:06 PM Document presentation format

Title: Traveling Salesman Problem and Multiple Sequence Alignment Author: weiwei Last modified by: rwr Created Date: 1/22/2003 9:38:06 PM Document presentation format

| PowerPoint PPT presentation | free to download

Sequence Alignment - we need a score for the substitution of the symbol i with j ... 'atoh' enhancer in human, mouse, rat, fugu fish. The local alignment problem ...

we need a score for the substitution of the symbol i with j ... 'atoh' enhancer in human, mouse, rat, fugu fish. The local alignment problem ...

| PowerPoint PPT presentation | free to view

Multiple Sequence Alignment - Multiple Sequence Alignment Urmila Kulkarni-Kale Bioinformatics Centre University of Pune urmila@bioinfo.ernet.in Approaches: MSA Dynamic programming Progressive ...

Multiple Sequence Alignment Urmila Kulkarni-Kale Bioinformatics Centre University of Pune urmila@bioinfo.ernet.in Approaches: MSA Dynamic programming Progressive ...

| PowerPoint PPT presentation | free to download

Sequence Alignment - S. B. Needleman ... max ( subproblem ( i 1, j ) , subproblem ( i, j 1 ) ); Memorizing ... gap x in sequence B } max { S[i, j y] w( y ); gap y in sequence ...

S. B. Needleman ... max ( subproblem ( i 1, j ) , subproblem ( i, j 1 ) ); Memorizing ... gap x in sequence B } max { S[i, j y] w( y ); gap y in sequence ...

| PowerPoint PPT presentation | free to view

Trees, Stars, and Multiple Biological Sequence Alignment PowerPoint PPT Presentation

Trees, Stars, and Multiple Biological Sequence Alignment - Forms an -dimensional parallelepiped. 02/19/2004. 7. Paths. 2 dimensions. 3 dimensions ... 3-dimensional parallelepiped. sublattice. Sequences DQLF, DNVQ, QGL ...

Forms an -dimensional parallelepiped. 02/19/2004. 7. Paths. 2 dimensions. 3 dimensions ... 3-dimensional parallelepiped. sublattice. Sequences DQLF, DNVQ, QGL ...

| PowerPoint PPT presentation | free to download

Multiple sequence alignment - Introduction to bioinformatics. Lecture 7. Multiple sequence ... DP recipe for using affine gap penalties (after ... One of he most important means to ...

Introduction to bioinformatics. Lecture 7. Multiple sequence ... DP recipe for using affine gap penalties (after ... One of he most important means to ...

| PowerPoint PPT presentation | free to download

Sequence Alignment PowerPoint PPT Presentations