Exon prediction by Genomic Sequence alignment Burkhard Morgenstern and Oliver Rinner - PowerPoint PPT Presentation


PPT – Exon prediction by Genomic Sequence alignment Burkhard Morgenstern and Oliver Rinner PowerPoint presentation | free to download - id: 23440e-N2IwZ


The Adobe Flash plugin is needed to view this content

Get the plugin now

View by Category
About This Presentation

Exon prediction by Genomic Sequence alignment Burkhard Morgenstern and Oliver Rinner


Task in bioinformatics: Find best multiple alignment for given sequence set ... Computer has to decide: which one is best?? Tools for multiple sequence alignment ... – PowerPoint PPT presentation

Number of Views:38
Avg rating:3.0/5.0
Slides: 84
Provided by: publ153
Learn more at: http://www.gobics.de


Write a Comment
User Comments (0)
Transcript and Presenter's Notes

Title: Exon prediction by Genomic Sequence alignment Burkhard Morgenstern and Oliver Rinner


Burkhard Morgenstern Institut für Mikrobiologie
und Genetik Molekulare Evolution und
Rekonstruktion von phylogenetischen Bäumen WS

  • Goal
  • Phylogeny reconstruction based on molecular
    sequence data (DNA, RNA, protein sequences)

Multiple sequence alignment
  • Molecular phylogeny reconstruction relies on
    comparative nucleic acid and protein sequence
  • Alignment most important tool for sequence
  • Multiple alignment contains more information than
    pair-wise alignment

Tools for multiple sequence alignment
  • Y I M Q E V Q Q E R
  • Sequence duplicates in history (e.g. speciation

Tools for multiple sequence alignment
  • Y I M Q E V Q Q E R

Tools for multiple sequence alignment
  • Y I M Q E V Q Q E R
  • Y I M Q E V Q Q E R

Tools for multiple sequence alignment
  • Y I M Q E A Q Q E R
  • Y L M Q E V Q Q E R
  • Substitutions occur

Tools for multiple sequence alignment
  • Y I M Q E A Q Q E R
  • Y L M Q E V Q Q E R

Tools for multiple sequence alignment
  • YAI M Q E A Q Q E R
  • Y L M - - V Q Q E R V
  • Insertions/deletions (indels) occur

Tools for multiple sequence alignment
  • YAI M Q E A Q Q E R
  • Y L M - - V Q Q E R V

Tools for multiple sequence alignment
  • Y A I M Q E A Q Q E R
  • Y L M V Q Q E R V
  • because of insertions/deletions sequence
    similarity no longer immediately visible!

Tools for multiple sequence alignment
  • Y A I M Q E A Q Q E R -
  • Y - L M V - - Q Q E R V
  • Alignment brings together related parts of the
    sequences by inserting gaps into sequences

Tools for multiple sequence alignment
  • Y A I M Q E A Q Q E R -
  • Y - L M V - - Q Q E R V

Tools for multiple sequence alignment
  • Y A I M Q E A Q Q E R -
  • Y - L M V - - Q Q E R V
  • Mismatches correspond to substitutions
  • Gaps correspond to indels

Tools for multiple sequence alignment
  • Pairwise alignment alignment of two sequences
  • Multiple alignment alignment of N gt 2 sequences

Tools for multiple sequence alignment
  • s1 R Y I M R E A Q Y E S A Q
  • s2 R C I V M R E A Y E
  • s3 Y I M Q E V Q Q E R
  • s4 W R Y I A M R E Q Y E
  • Assumtion sequence family related by common
    ancestry similarity due to common history
  • Sequence similarity not obvious (insertions and
    deletions may have happened)

Tools for multiple sequence alignment
  • s1 - R Y I - M R E A Q Y E S A Q
  • s2 - R C I V M R E A - Y E - - -
  • s3 - - Y I - M Q E V Q Q E R - -
  • s4 W R Y I A M R E - Q Y E - - -
  • Multiple alignment arrangement of sequences by
    introducing gaps
  • Alignment reveals sequence similarities

Tools for multiple sequence alignment
  • s1 - R Y I - M R E A Q Y E S A Q
  • s2 - R C I V M R E A - Y E - - -
  • s3 - - Y I - M Q E V Q Q E R - -
  • s4 W R Y I A M R E - Q Y E - - -

Tools for multiple sequence alignment
  • s1 - R Y I - M R E A Q Y E S A Q
  • s2 - R C I V M R E A - Y E - - -
  • s3 - - Y I - M Q E V Q Q E R - -
  • s4 W R Y I A M R E - Q Y E - - -

Tools for multiple sequence alignment
  • s1 - R Y I - M R E A Q Y E S A Q
  • s2 - R C I V M R E A - Y E - - -
  • s3 - - Y I - M Q E V Q Q E R - -
  • s4 W R Y I A M R E - Q Y E - - -
  • General information in multiple alignment
  • Functionally important regions more conserved
    than non-functional regions
  • Local sequence conservation indicates

Tools for multiple sequence alignment
  • s1 - R Y I - M R E A Q Y E S A Q
  • s2 - R C I V M R E A - Y E - - -
  • s3 - - Y I - M Q E V Q Q E R - -
  • s4 W R Y I A M R E - Q Y E - - -
  • Phylogeny reconstruction based on multiple
  • Estimate pairwise distances between sequences
    (distance-based methods for tree reconstruction)
  • Estimate evloutionary events in evolution
    (parsimony and maximum likelihood methods)

Tools for multiple sequence alignment
  • s1 - R Y I - M R E A Q Y E S A Q
  • s2 - R C I V M R E A - Y E - - -
  • s3 - - Y I - M Q E V Q Q E R - -
  • s4 W R Y I A M R E - Q Y E - - -
  • Task in bioinformatics Find best multiple
    alignment for given sequence set

Tools for multiple sequence alignment
  • s1 - R Y I - M R E A Q Y E S A Q
  • s2 - R C I V M R E A - Y E - - -
  • s3 - - Y I - M Q E V Q Q E R - -
  • s4 W R Y I A M R E - Q Y E - - -
  • Astronomical number of possible alignments!

Tools for multiple sequence alignment
  • s1 - R Y I - M R E A Q Y E S A Q
  • s2 - R C I V M R E A - - - Y E -
  • s3 Y I - - - M Q E V Q Q E R - -
  • s4 W R Y I A M R E - Q Y E - - -
  • Astronomical number of possible alignments!

Tools for multiple sequence alignment
  • s1 - R Y I - M R E A Q Y E S A Q
  • s2 - R C I V M R E A - - - Y E -
  • s3 Y I - - - M Q E V Q Q E R - -
  • s4 W R Y I A M R E - Q Y E - - -
  • Computer has to decide which one is best??

Tools for multiple sequence alignment
  • Questions in development of alignment programs
  • (1) What is a good alignment?
  • ? objective function (score)
  • (2) How to find a good alignment?
  • ? optimization algorithm
  • First question far more important !

Tools for multiple sequence alignment
  • Before defining an objective function (scoring
  • What is a biologically good alignment ??

Tools for multiple sequence alignment
  • Criteria for alignment quality
  • 3D-Structure align residues at corresponding
    positions in 3D structure of protein!

Tools for multiple sequence alignment
  • Criteria for alignment quality

Tools for multiple sequence alignment
  • Criteria for alignment quality
  • 3D-Structure align residues at corresponding
    positions in 3D structure of protein!

Tools for multiple sequence alignment
  • Species related by common history

Tools for multiple sequence alignment
  • Genes / proteins related by common history

Tools for multiple sequence alignment
  • Criteria for alignment quality
  • 3D-Structure align residues at corresponding
    positions in 3D structure of protein!
  • Evolution align residues with common ancestors!

Tools for multiple sequence alignment
  • s1 - R Y I - M R E A Q Y E S A Q
  • s2 - R C I V M R E A - Y E - - -
  • s3 - - Y I - M Q E V Q Q E R - -
  • s4 W R Y I A M R E - Q Y E - - -
  • Alignment hypothesis about sequence evolution
  • Mismatches correspond to substitutions
  • Gaps correspond to insertions/deletions

Tools for multiple sequence alignment
  • s1 - R Y I - M R E A Q Y E S A Q
  • s2 - R C I V M R E A - Y E - - -
  • s3 - - Y I - M Q E V Q Q E R - -
  • s4 W R Y I A M R E - Q Y E - - -
  • Alignment hypothesis about sequence evolution
  • Search for most plausible scenario!
  • Estimate probabilities for individual
    evolutionary events insertions/deletions,

Tools for multiple sequence alignment
  • s1 - R Y I - M R E A Q Y E S A Q
  • s2 - R C I V M R E A - Y E - - -
  • s3 - Y - I - M Q E V Q Q E R - -
  • s4 W R Y I A M R E - Q Y E - - -
  • Alignment hypothesis about sequence evolution
  • Search for most plausible scenario!
  • Estimate probabilities for individual
    evolutionary events insertions/deletions,

Tools for multiple sequence alignment
  • Compute score s(a,b) for degree of similarity
    between amino acids a and b based on probability
  • pa,b
  • of substitution
  • a ? b (or b ? a)
  • (Extremely simplified!)

Tools for multiple sequence alignment
Tools for multiple sequence alignment
  • Reason for different substitutin probabilities
  • Different physical and chemical properties of
    amino acids
  • Amino acids with similar properties more likely
    to be substituted against each other

(No Transcript)
Tools for multiple sequence alignment
  • Use penalty for gaps introduced into alignment
  • Simplest approach linear gap costs penalty
    proportional to gap length
  • Non-linear gap penalties more realistic long gap
    caused by single insertion/deletion
  • Most frequently used affine linear gap
    penalties more realistic, but efficient to

  • Traditional Objective functions
  • Define Score of alignments as
  • Sum of individual similarity scores s(a,b)
  • Minus gap penalties
  • Needleman-Wunsch scoring system for pairwise
    alignment (1970)

Pair-wise sequence alignment
  • T Y W I V
  • T - - L V
  • Example
  • Score s(T,T) s(I,L) s (V,V) 2 g
  • Assumption linear gap penalty!

Pair-wise sequence alignment
  • T Y W I V
  • T - - L V
  • Dynamic-programming algorithm finds
  • alignment with best score.
  • (Needleman and Wunsch, 1970)

Pair-wise sequence alignment
  • T Y W I V
  • T - - L V
  • Running time proportional to product of sequence
  • Time-complexity O(l1 l2)

Pair-wise sequence alignment
  • Algorithm for pairwise alignment can be
    generalized to multiple alignment of N sequences
  • Time-complexity O(l1 l2 lN)
  • Not feasable in reality (too long running time!)
  • Heuristic necessary, i.e. fast algorithm that
    does not necessarily produce mathematically best

Progressive Alignment
  • Most popular approach to (global) multiple
    sequence alignment
  • Progressive Alignment
  • Since mid-Eighties Feng/Doolittle,
    Higgins/Sharp, Taylor,

Progressive Alignment

Progressive Alignment
  • Guide tree

Progressive Alignment
  • Profile alignment, once a gap - always a gap

Progressive Alignment
  • Profile alignment, once a gap - always a gap

Progressive Alignment
  • Profile alignment, once a gap - always a gap

Progressive Alignment
  • Profile alignment, once a gap - always a gap

Progressive Alignment
  • Most important implementation CLUSTAL W

Progressive Alignment
  • CLUSTAL W Thompson et al., 1994 (17.000
  • Pairwise distances as 1 - percentage of identity
  • Calculate un-rooted tree with Neighbor Joining
  • Define root as central position in tree
  • Define sequence weights based on tree
  • Gap penalties calculated based on various

Tools for multiple sequence alignment
  • Problems with traditional approach
  • Results depend on gap penalty
  • Heuristic guide tree determines alignment
    alignment used for phylogeny reconstruction
  • Algorithm produces global alignments.

Tools for multiple sequence alignment
  • Problems with traditional approach
  • But
  • Many sequence families share only local
  • E.g. sequences share one conserved motif

The DIALIGN approach
  • Morgenstern, Dress, Werner (1996),
  • PNAS 93, 12098-12103
  • Combination of global and local methods
  • Assemble multiple alignment from
  • gap-free local pair-wise alignments
  • (,,fragments)

The DIALIGN approach
  • atctaatagttaaactcccccgtgcttag
  • cagtgcgtgtattactaacggttcaatcgcg
  • caaagagtatcacccctgaattgaataa

The DIALIGN approach
  • atctaatagttaaactcccccgtgcttag
  • cagtgcgtgtattactaacggttcaatcgcg
  • caaagagtatcacccctgaattgaataa

The DIALIGN approach
  • atctaatagttaaactcccccgtgcttag
  • cagtgcgtgtattactaacggttcaatcgcg
  • caaagagtatcacccctgaattgaataa

The DIALIGN approach
  • atctaatagttaaactcccccgtgcttag
  • cagtgcgtgtattactaacggttcaatcgcg
  • caaagagtatcacccctgaattgaataa

The DIALIGN approach
  • atctaatagttaaactcccccgtgcttag
  • cagtgcgtgtattactaacggttcaatcgcg
  • caaagagtatcacccctgaattgaataa

The DIALIGN approach
  • atctaatagttaaactcccccgtgcttag
  • cagtgcgtgtattactaacggttcaatcgcg
  • caaagagtatcacccctgaattgaataa

The DIALIGN approach
  • atc------taatagttaaactcccccgtgcttag
  • cagtgcgtgtattactaacggttcaatcgcg
  • caaagagtatcacccctgaattgaataa

The DIALIGN approach
  • atc------taatagttaaactcccccgtgcttag
  • cagtgcgtgtattactaacggttcaatcgcg
  • caaa--gagtatcacccctgaattgaataa

The DIALIGN approach
  • atc------taatagttaaactcccccgtgcttag
  • cagtgcgtgtattactaacggttcaatcgcg
  • caaa--gagtatcacc----------cctgaattgaataa

The DIALIGN approach
  • atc------taatagttaaactcccccgtgc-ttag
  • cagtgcgtgtattactaac----------gg-ttcaatcgcg
  • caaa--gagtatcacc----------cctgaattgaataa

The DIALIGN approach
  • atc------taatagttaaactcccccgtgc-ttag
  • cagtgcgtgtattactaac----------gg-ttcaatcgcg
  • caaa--gagtatcacc----------cctgaattgaataa

The DIALIGN approach
  • atc------TAATAGTTAaactccccCGTGC-TTag
  • cagtgcGTGTATTACTAAc----------GG-TTCAATcgcg
  • caaa--GAGTATCAcc----------CCTGaaTTGAATaa

More methods for multiple alignment
  • T-Coffee
  • PIMA
  • Muscle
  • Prrp
  • Mafft
  • ProbCons

Substitution matrices
  • Similarity score s(a,b) for amino acids a and b
    based on probability pa,b of substitution a -gt b
  • Idea it is more reasonable to align amino acids
    that are often replaced by each other!

Substitution matrices
  • Assumptions
  • pa,b does not depend on sequence position
  • Sequence positions independent of each other
  • pa,b pb,a (symmetry!)

Substitution matrices
  • Compute score s(a,b) for degree of similarity
    between amino acids a and b
  • Probability pa,b of substitution
  • a ? b (or b ? a),
  • Frequency qa of a
  • Define
  • s(a,b) log (pa,b / qa qb)


Substitution matrices
Substitution matrices
  • To calculate pa,b
  • Consider alignments of related proteins and count
  • a ? b (or b ? a)

Substitution matrices
  • To calculate pa,b
  • Consider alignments of related proteins and count
  • a ? b (or b ? a)

Substitution matrices
  • To calculate pa,b
  • Consider alignments of related proteins and count
  • a ? b (or b ? a)

Substitution matrices
  • Problems involved
  • Probability pa,b depends on time t since
    sequences separated in evolution pa,b pa,b
  • Protein families contain multiple sequences
    phylogenetic tree must be known!
  • Alignment of protein families must be known!
  • Multiple mutations at one sequence position

Substitution matrices
  • M. Dayhoff et al., Atlas of Protein sequence and
    Structure, 1978
  • PAM matrices

Substitution matrices
  • Calculation of pa,b(t)
  • Consider multiple alignments of closely related
    protein families
  • Count occurrence of a and b at corresponding
    positions in alignments using phylogenetic tree
  • Estimate pa,b(t) for small times t
  • Calculate conditional probabilities p(ab,t) for
    small t
  • Normalize to distance 1 PAM ( percentage of
    accepted mutations)
  • Calculate p(ab,t) for larger evolutionary
    distances by matrix multiplication
  • Calculate pa,b(t) for larger evolutionary

Substitution matrices
Substitution matrices
  • Alternative BLOSUM matrices
  • S. Henikoff and J.G. Henikoff, PNAS, 1992
  • Basis BLOCKS database, gap-free regions of
    multiple alignments.
  • Cluster of sequences if percentage of similarity
    gt L
  • Estimate pa,b(t) directly.
  • Default values L 62, L 50

About PowerShow.com