Bioinformatics The Prediction of Life - PowerPoint PPT Presentation


PPT – Bioinformatics The Prediction of Life PowerPoint presentation | free to download - id: 78aee6-NjEzN


The Adobe Flash plugin is needed to view this content

Get the plugin now

View by Category
About This Presentation

Bioinformatics The Prediction of Life


Bioinformatics The Prediction of Life Tony C Smith Department of Computer Science University of Waikato – PowerPoint PPT presentation

Number of Views:29
Avg rating:3.0/5.0
Slides: 41
Provided by: TonyC184
Learn more at:


Write a Comment
User Comments (0)
Transcript and Presenter's Notes

Title: Bioinformatics The Prediction of Life

BioinformaticsThe Prediction of Life
  • Tony C Smith
  • Department of Computer Science
  • University of Waikato

  • Computation with biological data
  • Data genes, proteins, microarrays, mass spectra,
    written documents, populations of organisms
  • Goal knowledge discovery

The essence is prediction
  • My dog is very littl_ ?
  • We know that letters do not occur in English at
    random not all letters are equally common (e.g.
    e is more common than x)
  • We know that context changes the probability of a
    letter (e.g. whats the most likely letter after
    the sequence I eat Weet-Bi_)
  • Prediction is important in many applications
    (e.g. encryption, compression, communication,
    graphics, simulation and bioinformatics!)

Prediction in bioinformatics
  • Predicting the location of genes in DNA
  • Predicting the function of proteins
  • Predicting diseases from molecular samples
  • Predicting population dynamics
  • Anything that involves making a judgment
    typically expressible as a yes/no decision about
    some sample datum

  • W e e t B i x
  • 0101011101100101011001010111010000101101
  • to the computer, everything is binary!

  • 0101011101100101011001010111010000101101
  • 0101101100100111111011010011010000101101
  • A A C G T C A T T C G A T G A T T C G
  • Just as we can teach a computer to predict
    things about a sequence of letters in English
    prose, we can also teach it to predict things
    about a other sequenceslike a genetic sequence

A genetic prediction problem
  • ttgcaatcggcgctacgcttcaaaatttattatattcccggcgcggcta

A genetic prediction problem
  • ttgcaatcggcgctacgcttcaaaatttattatattcccggcgcggcta

A genetic prediction problem
  • ttgcaatcggcgctacgcttcaaaatttattatattcccggcgcggcta

A genetic prediction problem
  • A gene encodes a protein
  • It is a blueprint that provides biochemical
    instructions on how to construct a sequence of
    amino acids so as to make a working protein that
    will perform some function in the organism

A genetic prediction problem

encoding region
untranslated region
A genetic prediction problem

untranslated region
A genetic prediction problem

untranslated region
A genetic prediction problem

What transcription factors bind to this
gene? Where is the transcription factor binding
A genetic prediction problem

A binding site is often a short general
pattern E.g. CCGATNATCGG
A genetic prediction problem

The patterns are often reverse complements E.g. C
A genetic prediction problem

Where there is one binding site, often there is
another nearby.
A genetic prediction problem

All of these properties are the kinds of things
for which computer science has developed
algorithms and data structures to identify
quickly and efficiently, and therefore it is
exactly the kind of problem computer scientists
should be able to solve.
Three consecutive nucleotides in the coding
region form a codon i.e. encode an amino
acid. A string of amino acids makes a protein.
3 nucleotides, 4 possibilities for each, so
43 64 possible codons But there are only
20 amino acids!
There is quite a bit of redundancy in codons.
Glycine GGA, GGC, GGG, GGT Tyrosine TAT,
TAC Methionine ATG
Amino Acid
R group
Amide group
Carboxyl group
Amino Acid
Tertiary Structure
Secondary Structure
Signal peptide
  • A relatively short sequence of amino residues at
    the N-terminus of the nascent protein
  • typically 15-50 residues
  • Cleaved off as protein passes through membrane
    (operates like a pass key)
  • Knowing signal peptide helps determine protein
    function in the organism

How do we do it?
  • see any patterns? ttgcaatcggcgctacgcttcaaaatttat

Local biases in residues around the cleavage site
Sequence regularities can be exploited by
statistical and pattern-based models
Proteomic prediction
Language letters combine to form words
words combine to form phrases phrases combine
to form sentences sentences combine to form
sentences (and ultimately Harry Potter
books) Proteins amino acids combine to form
peptides peptides combine to form secondary
motifs (e.g. a-helixes and ß-sheets)
motifs combine to make proteins proteins
combine to make toenails (and ultimately
  • Problem is stated as two-class
  • an amino acid is either the first residue of the
    mature protein or it is not
  • Each residue is described by a single document,
    which includes as many electrochemical,
    structural or contextual facts as are available

Properties of amino acids
Residue as a document
  • E.g. Cysteine Cys C
  • aliphatic yes, aromatic no, hydrophobic
    yes, charge -, polarized yes, small no,
    number of nitrogen atoms 1, contains sulphur
    yes, has a carbon ring no, ionized yes,
    valence 2, cbeta no, covalent yes, h-bond
  • etc. (whatever else experimenter wants to

Sample document
  • PRNUM1. AANUM21.
  • AMINO-8L. ALIPH-8-. AROMA-8-.
    CBETA-8-. CHARG-8-. COVAL-8-.
    HBOND-8-. HPHOB-8. IONIZ-8-.
    NITRO-81. POLAR-8-. POSNG-80.
    SMALL-8-. SULPH-8-. TEENY-8-.
    CRING-8-. VALEN-82. AMINO-7L.
    ALIPH-7-. AROMA-7-. CBETA-7-.
    CHARG-7-. COVAL-7-. HBOND-7-.
    HPHOB-7. IONIZ-7-. NITRO-71.
    POLAR-7-. POSNG-70. SMALL-7-.
    SULPH-7-. TEENY-7-. CRING-7-.
    VALEN-72. AMINO-6F. ALIPH-6.
    AROMA-6. CBETA-6-. CHARG-6-.
    COVAL-6-. HBOND-6-. HPHOB-6.
    IONIZ-6-. NITRO-61. POLAR-6-.
    POSNG-60. SMALL-6-. SULPH-6-.
    TEENY-6-. CRING-6. VALEN-62.
    AMINO-5A. ALIPH-5-. AROMA-5-.
    CBETA-5-. CHARG-5-. COVAL-5-.
    HBOND-5-. HPHOB-5-. IONIZ-5-.
    NITRO-51. POLAR-5-. POSNG-50.
    SMALL-5. SULPH-5-. TEENY-5.
    CRING-5-. VALEN-52. AMINO-4T.
    ALIPH-4. AROMA-4-. CBETA-4.
    CHARG-4-. COVAL-4-. HBOND-4.
    HPHOB-4-. IONIZ-4-. NITRO-41.
    POLAR-4. POSNG-40. SMALL-4.
    SULPH-4-. TEENY-4-. CRING-4-.
    VALEN-42. AMINO-3C. ALIPH-3.
    AROMA-3-. CBETA-3-. CHARG-3-.
    COVAL-3. HBOND-3. HPHOB-3.
    IONIZ-3. NITRO-31. POLAR-3.
    POSNG-3-. SMALL-3-. SULPH-3.
    TEENY-3-. CRING-3-. VALEN-32.
    AMINO-2I. ALIPH-2-. AROMA-2-.
    CBETA-2. CHARG-2-. COVAL-2-.
    HBOND-2-. HPHOB-2. IONIZ-2-.
    NITRO-21. POLAR-2-. POSNG-20.
    SMALL-2-. SULPH-2-. TEENY-2-.
    CRING-2-. VALEN-22. AMINO-1A.
    ALIPH-1-. AROMA-1-. CBETA-1-.
    CHARG-1-. COVAL-1-. HBOND-1-.
    HPHOB-1-. IONIZ-1-. NITRO-11.
    POLAR-1-. POSNG-10. SMALL-1.
    SULPH-1-. TEENY-1. CRING-1-.
    CRING8-. VALEN82. MULT37. MULT54.

Artificial Intelligence
  • Computers do things only human brains can
    otherwise do

Artificial Intelligence
  • Computers do things only human brains can
    otherwise do

expert system
Artificial Intelligence
  • Computers do things only human brains can
    otherwise do

learning system
expert system
Machine learning
What is machine learning?
  • creating computer programs that get better with
  • learn how to make expert judgments
  • discover previously hidden, potentially useful
    information (data mining)

How does it work?
  • user provides learning system with examples of
    concept to be learned
  • induction algorithm infers a characteristic model
    of the examples
  • model is used to predict whether or not future
    novel instances are also examples and it does
    this very consistently, and very, very quickly!

  • Biologists know proteins, computer scientists
    know machine learning
  • Together, they can find hidden and potentially
    useful information about genes and proteins
  • Biotechnology is a multi-billion dollar industry
  • Biotechnology is one of the best funded areas of
    scientific research
  • Shortage of people educated in bioinformatics

The University of Waikato
  • Waikato University is ranked first in the country
    in computer science and in molecular, cellular,
    and whole-organism biology
  • centre of the universe for machine learning

The University of Waikato
  • If youre interested in getting involved in
    bioinformatics, or indeed any other area along
    the leading edge of computer science and/or
    biology, then
  • Waikato wants You!