GENETIC MARKERS - PowerPoint PPT Presentation

About This Presentation
Title:

GENETIC MARKERS

Description:

DNA marker Molecular markers Resolution power allozymes (protein-electrophoresis) chloroplastDNA PCR-RFLP RAPD (random amplified polymorphic DNA) AFLP ... – PowerPoint PPT presentation

Number of Views:4142
Avg rating:3.0/5.0
Slides: 61
Provided by: SPENCERMa1
Category:

less

Transcript and Presenter's Notes

Title: GENETIC MARKERS


1
GENETIC MARKERS IN PLANT BREEDING
2
Marker
  • Gene of known function and location, or a
    mutation within a gene that allows studying the
    inheritance of that gene
  • Genetic information resides in the genome

Genetic Marker
Any phenotypic difference controlled by the
genes, that can be used for studying
recombination processes or selection of a more or
less closely associated target gene
3
Genetic Marker
  • Morphological marker
  • Molecular marker
  • Readily detectable sequence of protein or DNA
    that are closely linked to a gene locus and/or a
    morphological or other characters of a plant
  • Readily detectable sequence of protein or DNA
    whose inheritance can be monitored and associated
    with the trait inheritance independently from the
    environment
  • 1. Protein marker 2. DNA marker

4
Molecular markers
  • Sequencing (SNPs)
  • Microsatellites (SSRs)
  • AFLP(Amplified Fragment Length Polymorphism)
  • RAPD(random amplified polymorphic DNA)

Resolution power
  • chloroplastDNA PCR-RFLP
  • allozymes (protein-electrophoresis)

5
Morphological marker (phenotypic/naked eye
marker)
2-rowed 6-rowed
Black white
non-waxy waxy
hulled naked
6
Karl Von Linne (1707-1778)
7
Molecular markers
  • Important aspect
  • Polymorphism
  • The existence of two or more forms that are
    genetically distinct from one another but
    contained within the same interbreeding
    population
  • Pattern of inheritance
  • The pattern of genetic information transmission
    from parents to progeny

8
Polymorphism
9
Co-dominant marker
Polymorphism -Parent 1 one band -Parent 2 a
smaller band -Offspring 1 heterozygote both
bands -Offspring 2 homozygote parent 1

Dominant marker
Polymorphism Parent 1 one band -Parent 2 no
band -Offspring 1 homozygote parent
1 -Offspring 2 ????
10
Dominant versus Co-dominant
Dominant
No distinction between homo- and heterozygotes
possible
No allele frequencies available
RAPD
Co-dominant
Homozygotes can be distinguished from
heterozygotes Allele frequencies can be
calculated
microsatellites, SNP, RFLPs
11
Desirable properties for a good molecular marker
  • High Polymorphic
  • Co-dominant inheritance
  • Occurs throughout the genome
  • Reproducible
  • Easy, fast and cheap to detect
  • Selectivity neutral
  • High resolution with large number of samples
  • Nondestructive assay
  • Random distribution throughout the genome
  • Assay can be automated

12
Protein markers
Genetic markers which based on protein
polymorphisms
a. Allozyme isoenzymes of proteins nature
whose synthesis is usually controlled by
codominant alleles and inherited by monogenic
ratios. They show a specific banding pattern if
separated by electrophoresis b. Isozyme A species
of enzyme that exists in two or more structural
form, which are easily identified by
electrophoretic methods
13
Proteins Polymorphisms
Seed storage proteins
Isozymes
14
Isozyme
15
Isozyme
Starch gel of the isozyme malate dehydrogenase
(MDH). The numbers indicate first the MDH locus,
and next the allele present (ie. 3-18 is locus 3
allele 18). Some bands are heterodimers
(intralocus or interlocus).
16
DNA marker
Segments of DNA with an identifiable physical
location on a chromosome and whose inheritance
can be followed
A marker can be a gene, or it can be some
section of DNA with no known function
  • Types of DNA Marker can be differentiated based
    on molecular technique used to develop the marker
  • Restriction enzymes
  • Hybridization
  • PCR
  • Sequencing

17
DNA structure
Chromosome to DNA
18
DNA marker
readily detectable sequence of DNA whose
inheritance can be monitored and associated with
the trait inheritance
19
(No Transcript)
20
Basis for DNA marker technology
  • Restriction Endonucleases
  • DNA-DNA hybridization
  • Polymerase chain reaction (PCR)
  • DNA sequencing

21
RFLP techniques
22
RFLP Polymorphisms interpretation
6
23
RFLP based markers
  • Examine differences in size of specific DNA
    restriction fragments
  • Require pure, high molecular weight DNA
  • Usually performed on total cellular genome

Advantages and disadvantages of RFLP
  • Advantages
  • Reproducible
  • Co-dominant
  • Simple
  • Disadvantages
  • Time consuming
  • Expensive
  • Use of probes

24
AFLP Markers
  • Most complex of marker technologies
  • Involves cleavage of DNA with two different
    enzymes
  • Involves ligation of specific linker pairs to the
    digested DNA
  • Subsets of the DNA are then amplified by PCR
  • The PCR products are then separated on acrylamide
    gel
  • 128 linker combinations are readily available
  • Therefore 128 subsets can be amplified

25
(No Transcript)
26
(No Transcript)
27
(No Transcript)
28
AFLP Markers
  • Technically demanding
  • Reliable and stable
  • Moderate cost
  • Need to use different kits adapted to the size of
    the genome being analyzed.
  • Like RAPD markers need to be converted to quick
    and easy PCR based marker

29
RAPD
  • Amplifies anonymous stretches of DNA using
    arbitrary primers
  • Fast and easy method for detecting polymorphisms
  • Domimant markers
  • Reproducibility problems

30
RAPD Polymorphisms among landraces of sorghum
M
31
RAPD Markers
  • There are other problems with RAPD markers
    associated with reliability
  • Because small changes in any variable can change
    the result, they are unstable as markers
  • RAPD markers need to be converted to stable PCR
    markers.
  • How?

32
RAPD Markers
  • The polymorphic RAPD marker band is isolated from
    the gel
  • It is used a template and re-PCRed
  • The new PCR product is cloned and sequenced
  • Once the sequence is determined, new longer and
    specific primers can be designed

33
VNTRVariable Number of Tandem Repeats
  • Tandem repeats (TR)
  • DNA sequences which are existed in repeated
    numbers in the genome
  • Satellite DNA
  • Minisatellites
  • Microsatellites
  • Variable Number (VN)
  • High polymorphism in number of repeats

34
VNTRVariable Number of Tandem Repeats
  • Satellite DNA
  • 2-250 bp repeat unit size
  • Constitutes 1- 60 of the genome
  • Some can be separated in CsCl
  • satellite band
  • Minisatellites
  • 9-50 bp repeat unit size
  • 100 1000 x repeated
  • Microsatellites
  • 2-6 bp repeat unit size
  • 10s 100 x repeated

35
Microsatellites
  • Short tandem repeats (simple sequence repeat)
  • 2 dinucleotides
  • 3 trinucleotides
  • 4 tetranucleotides
  • Randomly distributed in genome
  • Non-coding
  • Some within coding sequences
  • Especially trinucleotides
  • Some related to diseases
  • Nomenclature
  • Perfect GCTAGCCACACACACACACATGCATC
  • Interrupted GCTAGCCACACGTCACACACTGCATC
  • Compound GCTAGCCACACATATATGTGTGCATC

36
SSR repeats and primers
37
SSR polymorphisms
Gel configuration
38
SNP (Single Nucleotide Polymorphisms)
  • Any two unrelated individuals differ by one base
    pair every 1,000 or so, referred to as SNPs.
  • Many SNPs have no effect on cell function and
    therefore can be used as molecular markers.

39
Genetic marker characteristics
Characteristics Morphological markers Protein markers RFLP markers RAPD markers SSR markers
Number of loci Limited Limited Almost unlimited Unlimited High
Inheritance Dominant Codominant Codominant Dominant Codominant
Positive features Visible Easy to detect Utilized before the latest technologies were available Quick assays with many markers Well distributed within the genome, many polymorphism
Negative features Possibly negative linkage to other characters Possibly tissue specific Radioactivity requirements, rather expensive High basic investment Long development of the markers, expensive
40
Developing a Marker
  • Best marker is DNA sequence responsible for
    phenotype i.e. gene
  • If you know the gene responsible and has been
    isolated, compare sequence of wild-type and
    mutant DNA
  • Develop specific primers to gene that will
    distinguish the two forms

41
Developing a Marker
  • If gene is unknown, screen contrasting
    populations
  • Use populations rather than individuals
  • Need to blend genetic differences between
    individual other than trait of interest

42
Developing Markers
  • Cross individual differing in trait you wish to
    develop a marker
  • Collect progeny and self or polycross the progeny
  • Collect and select the F2 generation for the
    trait you are interested in
  • Select 5 - 10 individuals in the F2 showing each
    trait
  • Extract DNA from selected F2s
  • Pool equal amounts of DNA from each individual
    into two samples - one for each trait
  • Screen pooled or bulked DNA with what method of
    marker method you wish to use

43
Types of traits (types of markers)
Multigenic trait ex plant growth Quantitative
Trait Loci
Single gene trait seed shape
44
USES OF MOLECULAR MARKER
  • Clonal identity
  • Parental analysis
  • Family structure
  • Population structure
  • Gene flow
  • Hybridisation
  • Phylogeny
  • Measure genetic diversity
  • Mapping
  • Tagging

45
Genetic Diversity
  • Define appropriate geographical scales for
    monitoring and management (epidemology)
  • Establish gene flow mechanism
  • identify the origin of individual (mutation
    detection)
  • Monitor the effect of management practices
  • manage small number of individual in ex situ
    collection
  • Establish of identity in cultivar and clones
    (fingerprint)
  • paternity analysis and forensic

46
Genetic Diversity
47
Mapping
  • The determination of the position and relative
    distances of gene on chromosome by means of their
    linkage
  • Genetic map
  • A linear arrangement of genes or genetic markers
    obtained based on recombination
  • An ordering of genes and markers in a linear
    arrangement corresponding to their physical order
    along the chromosome, based on linkage.
  • Physical map
  • A linear order of genes or DNA fragments
  • An ordering of landmarks on DNA, regardless of
    inheritance, measured in base pairs.

48
Physical Mapping
  • It contains ordered overlapping cloned DNA
    fragment
  • The cloned DNA fragments are usually obtained
    using restriction enzyme digestion

49
QTL Mapping
  • A set of procedures for detecting genes
    controlling quantitative traits (QTL) and
    estimating their genetics effects and location
  • ? To assist selection

50
Fundamental Genetics (Background for Linkage
Analysis)
  • Rule of Segregation
  • offspring receive ONE allele (genetic material)
    from the pair of alleles possessed by BOTH
    parents
  • Rule of Independent Assortment
  • alleles of one gene can segregate independently
    of alleles of other genes
  • (Linkage Analysis relies on the violation of
    Independent Assortment Rule)

51
Linkage Analysis
  • Goal
  • find a marker linked to a disease gene.
  • LOD score log of likelihood ratio
  • LR?data k Pdata ?
  • ? estimate of genetic distance
    (recombination fraction) between marker and
  • quantitative traits
  • proportion of recombinant gametes/total gametes

52
Linkage Analysis
  • Genes near each other on a chromosome tend to be
    inherited together, that is, they are linked.
  • Linkage analysis are the techniques used to
    identify such linkages among genes
  • Linkage groups which include genetic markers and
    genes determinative of phenotype allow the
    identification of determinative alleles (and
    therefore prediction)

53
Linkage
  • Mendel showed that alleles segregate
    independently. Then he tested genes
  • Sometimes inheritance of two genes are
    independent of another, that is phenotype ratios
    are 9331
  • Sometimes inheritance of two genes are linked
    together, showing a ratio of 3001
  • Linkage can vary continuously from perfectly
    correlated to uncorrelated.

54
Why genes are linked
  • Alleles are arranged linearly
  • Each parent passes only one of its two
    chromosomes to an offspring.
  • Recombination periodically switches which
    chromosome in the parent is passed along
  • Alleles near each other are more likely to be
    passed along than ones further apart
  • Alleles on different chromosomes are always
    inherited independently.

55
Marker Assisted Selection
  • Breeding for specific traits in plants and
    animals is expensive and time consuming
  • The progeny often need to reach maturity before a
    determination of the success of the cross can be
    made
  • The greater the complexity of the trait, the more
    time and effort needed to achieve a desirable
    result.

56
MAS
  • The goal to MAS is to reduce the time needed to
    determine if the progeny have trait
  • The second goal is to reduce costs associated
    with screening for traits
  • If you can detect the distinguishing trait at the
    DNA level you can identify positive selection
    very early.

57
Marker Assisted Breeding
  • MAS allows for gene pyramiding - incorporation of
    multiple genes for a trait
  • Prevents development of biological resistance to
    a gene
  • Reduces space requirements - dispose of unwanted
    plants and animal early

58
QTL study
P.1 P.2 I.1 I.2 I.3 I.4
Statistical programs used in molecular marker
studies SAS ANOVA Mapmaker Cartographer
Types of population used for molecular markers
studies F2, RILs, Backcrosses (MILs), DH.
59
QTL Mapping
60
Recombination picture
  • Crossover is the alternation of allele generating
    chromatid (half of chromosome)
Write a Comment
User Comments (0)
About PowerShow.com