Title: A novel mutation in the AVPR2 gene in a Palestinian family with nephrogenic diabetes insipidus
1A novel mutation in the AVPR2 gene in a
Palestinian family with nephrogenic diabetes
insipidus
- Abdulsalam Abu Libdeh, MD
- Pediatric Endocrinologist
- Makassed Islamic Hospital
2Case presentation
- 3 months old male infant, referred from Al-Watani
hospital c/o fever, irritability, FTT and
vomiting. - Past history
- product of FT,NVD, birth wt 3.6kg, at
Rafidia hospital. - At 22d of age admitted to Al-Watani hospital
as he developed fever, irritability, vomiting and
FTT.
3Case presentation
- Investigations at al-Watani
- Na 177 K 4.5 Urea 44
Crea 0.9 - LFT NL CBC NL Urinalysis
free - Family history
Parents were healthy and
not consanguineous. A male sibling was diagnosed
clinically previously to have nephrogenic
diabetes insipidus. - He was started on hydrochlorothiazide 2mg/kg/day,
but due to inadequate response, the patient was
referred to Makassed hospital. -
4Case presentation
- Physical Examination
- Wt 4.42kg lt3rd
- Lt 58cm 25th
- Hc 37.5cm lt3rd
- Temp 37c HR 130/min BP
72/45 - Positive findings on P/E
- Cachectic , irritable
-
5Case presentation
- Investigations
Na 150 K
3.7
s.osmolality 304mOsm/kg - BUN 13 Crea 0.5
- LFT NL Glu 97
- CBC NL
- Blood gas PH 7.52, HCO3 29, BE 6
- Urine osmolality 145mOsm/kg
- Na 27
-
6Family pedigree
7Case presentation
- Investigations
Urine output 9cc/kg/hr - Urine culture positive for Klebsiella
- Blood culture negative
- Renal U/S normal
- GFR 43ml/min/1.73m2
-
8- Diagnosis
- Diabetes Insipidus
Central
Nephrogenic
9Management
- Minirin test
-
- Diagnosis Nephrogenic Diabetes Insipidus
S.osmolality Serum Na Urine osm
Before 304 149 65
After 318 157 96
10Management
- Kaluril (Amiloride hydrochlorothiazide)
4mg/kg/day - Indomethacin 2mg/kg/day
- Feeding 180cc/kg/day (oral gavage)
- Upon discharge
Na 139 s.osm 323mOsm/kg
urine osm 85mOsm/kg
U.O.P 2.4cc/kg/hr
Wt 5.1kg -
11Molecular diagnosis
12Sequencing of AVPR2
- Primers for amplification and sequencing of the
AVPR2 gene were - Exon 1 For attgaacttgctcctcaggc
Rev. gcttccctgaatcgtcaaac - Exon 2-start For ctaggagccaggaagtggg
Rev. gaagatgaagagctggggc - Exon 2-end For tcctcctacatgatcctggc
Rev. tggaggatctaggttgggttc - Exon 3 For gtggctagggctgacgg Rev.
ccagtggctcccaggac
13Sequence result
Patient
Sequencing the DNA of the affected patient showed
mis-sense mutation with replacement of G by A in
codon 82 (TGC---TAC). This mutation predicted a
substitution of Cysteine to Tyrosine (C82Y) at
the amino acid residue of the AVPR2 gene
14Sequence result
Mother
Mother was heterozygous for this mutation
(carrier)
15Sequence result
Father
16Sequence result
Sister
Sister was heterozygous for this mutation
(carrier)
17AVPR2
183-D Model of the AVPR2
19Nephrogenic Diabetes Insipidus
- Definition
NDI is a clinical
disorder, characterized by a urinary
concentrating defect resulting from resistance of
the collecting duct to the antidiuretic action of
vasopressin (AVP).
20Nephrogenic Diabetes Insipidus
- Classification
Hereditary
X-linked
V2R
Autosomal recessive
AQP2 Autosomal dominant
AQP2 Acquired
Drugs (lithium, amphotericin B)
Ureteral obstruction
Acute or chronic renal failure
Renal cystic disease
Interstitial
nephritis
Nephrocalcinosis
Toxic nephropathy due to hypokalemia
21X-linked Nephrogenic Diabetes Insipidus
- X-linked recessive NDI is caused by mutations in
the gene encoding the V2 vasopressin receptor
(V2R) and is the most frequent genetic cause of
the inherited NDI. - To date, 178 different mutations have been
reported for V2R NDI, and the mutations spread
throughout all portions of the protein.
22X-linked NDI
- There are two different receptors for ADH
V1 (AVPR1) V2 (AVPR2) receptors. - Activation of the V1 receptors-
- a. Induces vasoconstriction
- b. Enhancement of prostaglandin release, while
- Activation of V2 receptors-
- a. Mediate the antidiuretic responses.
- b. Peripheral vasodilation
- c. The release of factor VIIIc and von
Willbrands - factor from endothelial cells.
23X-linked NDI
Pathogenesis
24X-linked NDI
- Clinical manifestations
Massive polyuria - Volume depletion
- Hypernatremia
- Hyperthermia
- Irritability
- Constipation
- FTT
Developmental delay mental
retardation
25X-linked NDI
- Clinical manifestations
Diminished appetite poor food
intake due to consumption of large volume of
water - Growth abnormalities.
- Behavioral problems, including hyperactivity
short term memory problems.
26Nephrogenic Diabetes Insipidus
- Diagnosis
water deprivation test
If the serum osmolality is 290mOsm/kg
or higher with a urine osmolality value
lt290mOsm/kg, water deprivation test is not
necessary.
To distinguish between
central DI NDI administration of vasopressin
10-20mcg, followed by serial urine and serum
osmolality measurements hourly for 4hrs.
27Treatment of NDI
- Maintenance of adequate fluid intake access to
free water. Infants require gastrostomy or NG
tube feeding to ensure adequate fluid
administration throughout day night. - Minimizing urine output by limiting solute load
with a low osmolar, low-sodium diet. For
infants, human milk or a low solute formula, such
as Similac PM 60/40 is preferred.
28Treatment of NDI
- Administering medications directed at decreasing
urine output.
Thiazide diuretics (2-3mg/kg/d) effectively
induce Na loss stimulate proximal tubule
reabsorption of water.
Potassium-sparing diuretics,
amiloride (0.3mg/kg/d) by its additive effect
with thiazide are often indicated.
29Treatment of NDI
- NSAIDs indomethacin (2mg/kg/d) has an additive
effect in reducing water excretion in some
patients, dependent upon inhibition of renal
prostaglandin synthesis. - Exogenous ADH most patients with NDI have
partial rather than complete resistance to ADH.
It is therefore possible that attaining
supraphysiologic hormone levels will increase the
renal effect of ADH to a clinically important
degree.
30Treatment of NDI
- Experimental approaches most patients with
congenital x-linked NDI have defective V2
vasopressin receptors that are unable to properly
fold intracellularly and, as a consequence,
correctly transfer to the cell surface.
In vitro, the
administration of selective, cell permeable
nonpeptide V2 and V1a receptor antagonists were
able to rescue mutant V2 receptors by promoting
their proper folding and maturation. This
resulted in the expression of functional cell
surface V2 receptors, suggesting that such a
therapeutic approach may be fruitful.
31A novel mutation in the AVPR2 gene in a
Palestinian family with nephrogenic diabetes
insipidus
- Abu Libdeh Abdulsalam, Dweikat Imad Abu-Libdeh
Bassam - Department of Pediatrics, Makassed Hospital,
Jerusalem
32Thank you for your attention