Next Generation Sequencing in Science and Medicine The - PowerPoint PPT Presentation

Loading...

PPT – Next Generation Sequencing in Science and Medicine The PowerPoint presentation | free to download - id: 3b62e6-ZTMxN



Loading


The Adobe Flash plugin is needed to view this content

Get the plugin now

View by Category
About This Presentation
Title:

Next Generation Sequencing in Science and Medicine The

Description:

Next Generation Sequencing in Science and Medicine The Presidential Commission for the Study of Bioethical Issues 28 February 2011 Washington D.C. – PowerPoint PPT presentation

Number of Views:440
Avg rating:3.0/5.0
Slides: 28
Provided by: bioethics8
Learn more at: http://bioethics.gov
Category:

less

Write a Comment
User Comments (0)
Transcript and Presenter's Notes

Title: Next Generation Sequencing in Science and Medicine The


1
Next Generation Sequencing in Science and Medicine
  • The Presidential Commissionfor the Study of
    Bioethical Issues
  • 28 February 2011
  • Washington D.C.

Jim Evans MD, Ph.D University of North Carolina
at Chapel Hill
2
DNA Has Only Two Jobs
  • It serves as a store of information
  • Ensuring that information is passed on to each
    new cell upon division (and the next generation)
  • It directs the synthesis of proteins
  • Which are necessary to carry out the functions of
    a living organism

3
DNAs Structure Explains How it Accomplishes Both
Jobs
DNA Serves as a Store of Information
A
C
T
G
T
A
G
C
Adenine (A)
Cytosine (C)
Always binds to
Always binds to
Thymine (T)
Guanine (G)
As a double helix, each DNA molecule contains a
copy of itself
4
DNAs Structure Explains How it Accomplishes Both
Jobs
DNA Directs the Synthesis of Proteins
  • It is the order of the bases that provides the
    instructions for protein synthesis
  • One stretch of DNA directs the synthesis of one
    type of protein, another stretch directs the
    synthesis of another type of protein

5
We call a stretch of DNA that directs the
synthesis of one particular protein a Gene
Gene 1
Gene 2
Gene 3
6
DNA Sequencing
  • You have 3 billion bases arrayed in a unique
    order, with 20,000 genes that direct the
    synthesis of all the proteins that comprise you
  • Sequencing DNA is simply the elucidation of the
    order of the bases in an organisms DNA strand
  • The unique order of your bases greatly influences
    your health, e.g.
  • What disease you are more - or less - prone to
  • How you will react to different medications
  • A human genome is about 6 feet of DNA
  • And each of your cells contains two copies of
    your genome

7
A Human DNA Sequence
atcgtgactgattaccaggatcctagcggatcctactgacctgacgtacg
taatgcagtggtcaggttgttcaactcgatgactagaatatatccaggaa
aatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagt
cggtacgtttccaggctacacacacactgacagatagacagattgtcgtg
ttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtac
gtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaat
ccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcgg
tacgtttccaggctacacacacactgacagatagacagattgtcgtgtta
tvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgta
cggtactggtaacgtgaggtcaggttgttcaactcatcgtgactgattac
caggatctactagaagaaaaattgggccctacgtaccgtaacgttgcaaa
ttcagtcggtacgtttccaggctacacacacactgacagatagacagatt
gtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgta
acgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccag
gaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattc
agtcggtacgtttccaggctacacacacactgacagatagacagattgtc
gtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacg
tactagaatatatccaggaaaatccctgggaaaaattggaacgttgcaaa
ttcagtcggtacgtttccaggctacacacacactgacagatagacagatt
gtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgta
acgtacgtagccctacgtaccgtcggtactggtaacgtgaggtcaggttg
ttcaactcatccaggattagatccgtagatcgtaggaaatatctcggata
attaacagatacacacccttagaccatttaaatccctgggaaaaattggg
ccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctaca
cacacactgacagatagacagattgtcgtgttatvtgacttggaactgta
ggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtga
ggtcaggttgttcaactcatcgtgactgattaccaggatcctagcggatc
ctactgacctgacgtacgtaatgcagtggtcaggttgttcaactcgatga
ctagaatatatccaggaaaatccctgggaaaaattgggccctacgtgtcg
taacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatcc
aggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaat
tcagtcggtacgtttccaggctacacacacactgacagatagacagattg
tcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaa
cgacgtttccaggctacacacacactgacagatagacagattcaaattca
gtcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtga
ggtcaggttgttcaactcatcgtgactgattaccaggatcctagcggatc
ctactgacctgacgtacgtaatgcagtggtcaggttgttcaactcgatga
gaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtt
tccaggctacacacacactgacagatagacagattgtcgtgttatvtgac
ttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtac
tggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaa
aaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttcc
aggctacacacacactgacagatagacagattgtcgtgttatvtgacttg
gaactgtaggcccttgaatcttggcagtcgtaacgtactagaatatatcc
aggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaat
tcagtcggtacgtttccaggctacacacacactgacagatagacagattg
tcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaa
cgtacgtacggtactggtaacgtgaggtcaggttgttcatatatccagga
aaatccctgggaaaaattggctacgtaccgtattaactaggatctccgat
ggtacccattaagacacccaaaataggtaacaggtagacatattgatacc
catagaggatagatttaggacgttgcaaattcagtcggtacgtttccagg
ctacacacacactgacagatagacagattgtcgtgttatvtgacttggaa
ctgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaa
cgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattg
ggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggcta
cacacacactgacagatagacagattgtcgtgttatvtgacttggaactg
taggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgt
gaggtcaggttgttcaactcatcgtgactgattaccaggatcctagcgga
tcctactgacctgacgtacgtaatgcagtggtcaggttgttcaactcgat
gagaaaaattgggccctacgtaccgtaacgttgtacgtttccaggctaca
cacacactgacagatagacagattgtcgtgttatvtgacttggaactgta
ggcccttgaatcttggcagtcgtaacgtactagaatatatccaggaaaat
ccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcgg
tacgtttccaggctacacacacactgacagatagacagattgtcgtgtta
tvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgta
cggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccc
tgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtac
gtttccagctacacacacactgacagatagacagattgtcgtgttatvtg
acttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggg
tactggtaacgtgaggtcaggttgttcaactcatcgtgactgattaggaa
aatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagt
cggtacgtttccaggctacacacacactgacagatagacagattgtcgtg
ttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtac
gtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaat
ccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcgg
tacgtttccaggctacacacacactgacagatagacagattgtcgtgtta
tvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgta
cggtactggtaacgtgaggtcaggttgttcaactcatcgtgactgattac
caggatcctagcggatcctactgacctgacgtacgtaatgcagtggtcag
gttgttcaactcgatgagaaaaattgggccctacgtaccgtaacgttgca
aattcagtcggtacgtttccaggctacacacacactgacagatagacaga
ttgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcg
taacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatcc
aggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaat
tcagtcggtacgtttccaggctacacacacactgacagatagacagattg
tcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaa
cgtactagaatatatccaggaaaatccctgggaaaaattgggccctacgt
accgtaacgttgcaaattcagtcggtacgtttccaggctacacacacact
gacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttg
aatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggt
tgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtacc
gtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgac
agatagacagattgtcgtgttatvtgacttggaactgtaggcccttgacg
tacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatc
cctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggt
acgtttccaggctacacacacactgacagatagacagattgtcgtgttat
vtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtac
ggtactggtaacgtgaggtcaggttgttcaactcatcgtgactgattacc
aggatcctagcggatcctactgacctgacgtacgtaatgcagtggtcagg
ttgttcaactcgatgactagaatatatccaggaaaatccctgggaaaaat
tgggccctacgtgtcgtaacgtacgtacggtactggtaacgtgaggtcag
gttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgta
ccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactg
acagatagacagattgtcgtgttatvtgacttggaactgtaggcgccttg
aatcttggcagtcgtaacgtactagaatatatccaggaaaatccctggga
aaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttc
caggctacacacacactgacagatagacagattgtcgtgttatvtgactt
ggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactg
gtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaa
attgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccag
gctacacacacactgacagatagacagattgtcgtgttatvtgacttgga
actgtaggcacacacacactgacagagacagattgtcgtgttatvtgact
tggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtact
ggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaa
aattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttcca
ggctacacacacactgcagatagacagattgtcgtgttatvtgacttgga
actgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggta
acgtgagagtcaggttgttcaactcatcgtgactgattaccaggatccta
gcggatcctactgacctgacgtacgtaatgcagtggtcaggttgttcaac
tcgatgagaaaaattgggccctacgtaccgtaacgttgcaaattcagtcg
gtctagcggatcctactgacctgacgtacgtaatgcagtggtcaggttgt
tcaactcgatgactagaatatatccaggaaaatccctggactcatccagg
aaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattca
gtcggtacgtttccaggctacacacacactgacagatagacagattgtcg
tgttatvtgacttggaactgtaggcccttgaatcttggca
  • 1/1,000,000th of the Human Genome
  • Interspersed with genes
  • And polymorphisms which differ between people
  • Are sometimes important, influencing traits
  • or medically important characteristics

8
Sequencing DNA
  • Early techniques were developed in the 1970s
  • A variety of approaches now exist
  • The biggest limitation to sequencing is that the
    genome is big
  • So carrying out these reactions for an entire
    genome is slow and expensive

9
Next Generation Sequencing
  • Takes advantage of miniaturization to engage in
    massively parallel analysis
  • Essentially carrying out millions of sequencing
    reactions simultaneously in each of 10 million
    tiny wells
  • Sophisticated computer analysis of huge amounts
    of information allows assembly" of a given
    sequence

10
Accelerating Technology Plummeting Cost
795 in 1977 (2,800 in current )
11
Genomics Long Term Promise
  • An avalanche of Genome Wide Association Studies
    (GWAS) in common diseases
  • WGS is now a practical reality
  • Will shed light on the genetic underpinnings of
    every disease imaginable

Ultimately transforming Medical Science
12
Medical Science Medical Practice
  • Medical Science is the indispensible foundation
    of Medical Practice
  • But medical practice is far more complex
  • More variables
  • Individual values matter and they differ
  • Theory alone is insufficient to guide practice
  • Time-line for translation is long
  • Successful translation into practice
    is not
    guaranteed by scientific understanding
  • See sickle cell disease
  • Its far more expensive
  • The stakes are much higher in Medical Practice
  • Because the power to harm is real and potent

13
Where Does the Clinical Promise of Genomics
Lie?Probably not in risk assessment for common
disease
Probably not in simply assessing risk
  • Common diseases have many factors, of which
    genetics is only one
  • The bulk of any individuals genetic risk for
    common disease is modest
  • Thus assessing genetic risk only nudges that
    risk slightly
  • Few data to suggest that knowledge of ones
    genomic status for common disease is useful or is
    effective in changing behavior

Genetics
Diabetes
Diet
Exercise
Smoking
Hypertension
14
Whats The Right Nail For Sequencing Technology?
  • As a diagnostic tool in enigmatic patients
  • As a public health tool to identify those
    apparently well individuals with dramatically
    increased risk of preventable disease

15
Next Generation Sequencing as a Clinical
Diagnostic Tool
  • 47 yo female with sudden cardiac arrest
  • Resuscitated successfully
  • EKG reveals Long QT Syndrome
  • High risk for sudden death
  • Dozens of genes implicated
  • Application of NGS to detect mutation
  • Thereby guiding patients treatment and
    prevention of death in family members

16
Next Generation Sequencing as a Public Health Tool
  • 0.25 of US women (375,000) carry a mutation in
    BRCA1/2
  • At very high risk of breast and ovarian cancer
  • 85 lifetime breast cancer risk
  • 25-50 lifetime ovarian cancer cancer
  • Knowledge of risk allows prevention
  • Currently we only can identify such women once
    several family members have developed cancer
  • NGS allows population screening for high risk
    preventable disorders
  • Cancer predisposition, cardiac disease, etc.
  • 1-2 of population carry such mutations
  • 3-6 million individuals in the US with
    preventable disorders if identified

17
Challenges to Harnessing NGS in Clinical Medicine
Public Health
  • Accuracy
  • 99.99 accuracy x 3 billion nucleotides
  • 300,000 errors per patient
  • Interpretation of the variants we find
  • Storage and access in the medical record
  • Education of patients and public
  • Issues of consent and reporting
  • Education of providers

18
Incidental Information
  • Upon WGS we discover many things we weren't
    looking for, which we can do nothing about
  • Some are trivial or indeed beneficial
  • But some are problematic
  • And we will occasionally discover lethal,
    untreatable late onset conditions
  • Some wish to know such information others do not
  • We must grapple with how to inform patients about
    such information
  • protect patients from harm but also allow
    individual autonomy

    and choice

19
In the Clinical Arena, Genetic Information
Presents Few Qualitatively New Challenges
Eschewing Genetic Exceptionalism
  • Genetic tests affect others
  • Infectious Disease
  • Provide probabilistic information to the
    asymptomatic
  • Cholesterol
  • Our genome cannot be changed
  • Nor can much of what we discover medically
  • Insurance discrimination
  • Actually better for genetics than the rest of
    medicine
  • Unexpected results, FPs/FNs
  • Are a routine part of all clinical care
  • DNA is uniquely identifiable
  • Zip code DOB spouses first name

20
Challenges to Realizing Genomic Medicine
  • Creation of a centralized, evidence-based,
    iterative process to define clinically
    significant genomic findings
  • Thorough health-oriented phenotypic annotation of
    variants
  • Enabling realistic shared decision making among a
    range of providers, technology interfaces and
    patients
  • Understanding the ethical dimensions, patient
    preferences values regarding returning
    incidental results
  • Maintaining a sober focus on evidence

Life is short, the art long, opportunity
fleeting, experience delusive, judgment difficult
21
(No Transcript)
22
(No Transcript)
23
(No Transcript)
24
A Human DNA Sequence
atcgtgactgattaccaggatcctagcggatcctactgacctgacgtacg
taatgcagtggtcaggttgttcaactcgatgactagaatatatccaggaa
aatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagt
cggtacgtttccaggctacacacacactgacagatagacagattgtcgtg
ttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtac
gtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaat
ccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcgg
tacgtttccaggctacacacacactgacagatagacagattgtcgtgtta
tvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgta
cggtactggtaacgtgaggtcaggttgttcaactcatcgtgactgattac
caggatctactagaagaaaaattgggccctacgtaccgtaacgttgcaaa
ttcagtcggtacgtttccaggctacacacacactgacagatagacagatt
gtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgta
acgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccag
gaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattc
agtcggtacgtttccaggctacacacacactgacagatagacagattgtc
gtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacg
tactagaatatatccaggaaaatccctgggaaaaattggaacgttgcaaa
ttcagtcggtacgtttccaggctacacacacactgacagatagacagatt
gtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgta
acgtacgtagccctacgtaccgtcggtactggtaacgtgaggtcaggttg
ttcaactcatccagga/taaatccctgggaaaaattgggccctacgtacc
gtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgac
agatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaat
cttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgt
tcaactcatcgtgactgattaccaggatcctagcggatcctactgacctg
acgtacgtaatgcagtggtcaggttgttcaactcgatgactagaatatat
ccaggaaaatccctgggaaaaattgggccctacgtgtcgtaacgtacgta
cggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccc
tgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtac
gtttccaggctacacacacactgacagatagacagattgtcgtgttatvt
gacttggaactgtaggcccttgaatcttggcagtcgtaacgacgtttcca
ggctacacacacactgacagatagacagattcaaattcagtcccttgaat
cttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgt
tcaactcatcgtgactgattaccaggatcctagcggatcctactgacctg
acgtacgtaatgcagtggtcaggttgttcaactcgatgagaaaaattggg
ccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctaca
cacacactgacagatagacagattgtcgtgttatvtgacttggaactgta
ggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtga
ggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccc
tacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacac
acactgacagatagacagattgtcgtgttatvtgacttggaactgtaggc
ccttgaatcttggcagtcgtaacgtactagaatatatccaggaaaatccc
tgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtac
gtttccaggctacacacacactgacagatagacagattgtcgtgttatvt
gacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacgg
tactggtaacgtgaggtcaggttgttcatatatccaggaaaatccctggg
aaaaattggctacgtaccgta/gacgttgcaaattcagtcggtacgtttc
caggctacacacacactgacagatagacagattgtcgtgttatvtgactt
ggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactg
gtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaa
attgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccag
gctacacacacactgacagatagacagattgtcgtgttatvtgacttgga
actgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggta
acgtgaggtcaggttgttcaactcatcgtgactgattaccaggatcctag
cggatcctactgacctgacgtacgtaatgcagtggtcaggttgttcaact
cgatgagaaaaattgggccctacgtaccgtaacgttgtacgtttccaggc
tacacacacactgacagatagacagattgtcgtgttatvtgacttggaac
tgtaggcccttgaatcttggcagtcgtaacgtactagaatatatccagga
aaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcag
tcggtacgtttccaggctacacacacactgacagatagacagattgtcgt
gttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgta
cgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaa
tccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcg
gtacgtttccagctacacacacactgacagatagacagattgtcgtgtta
tvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgta
cgggtactggtaacgtgaggtcaggttgttcaactcatcgtgactgatta
ggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaatt
cagtcggtacgtttccaggctacacacacactgacagatagacagattgt
cgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaac
gtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccagga
aaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcag
tcggtacgtttccaggctacacacacactgacagatagacagattgtcgt
gttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgta
cgtacggtactggtaacgtgaggtcaggttgttcaactcatcgtgactga
ttaccaggatcctagcggatcctactgacctgacgtacgtaatgcagtgg
tcaggttgttcaactcgatgagaaaaattgggccctacgtaccgtaacgt
tgcaaattcagtcggtacgtttccaggctacacacacactgacagataga
cagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggca
gtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactc
atccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgc
aaattcagtcggtacgtttccaggctacacacacactgacagatagacag
attgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtc
gtaacgtactagaatatatccaggaaaatccctgggaaaaattgggccct
acgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacaca
cactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcc
cttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtc
aggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacg
taccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacac
tgacagatagacagattgtcgtgttatvtgacttggaactgtaggccctt
gacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaa
aatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagt
cggtacgtttccaggctacacacacactgacagatagacagattgtcgtg
ttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtac
gtacggtactggtaacgtgaggtcaggttgttcaactcatcgtgactgat
taccaggatcctagcggatcctactgacctgacgtacgtaatgcagtggt
caggttgttcaactcgatgactagaatatatccaggaaaatccctgggaa
aaattgggccctacgtgtcgtaacgtacgtacggtactggtaacgtgagg
tcaggttgttcaactcatccaggaaaatccctgggaaaaattgggcccta
cgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacac
actgacagatagacagattgtcgtgttatvtgacttggaactgtaggc/g
ccttgaatcttggcagtcgtaacgtactagaatatatccaggaaaatccc
tgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtac
gtttccaggctacacacacactgacagatagacagattgtcgtgttatvt
gacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacgg
tactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgg
gaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtt
tccaggctacacacacactgacagatagacagattgtcgtgttatvtgac
ttggaactgtaggcacacacacactgacagagacagattgtcgtgttatv
tgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacg
gtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctg
ggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgt
ttccaggctacacacacactgcagatagacagattgtcgtgttatvtgac
ttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtac
tggtaacgtgagagtcaggttgttcaactcatcgtgactgattaccagga
tcctagcggatcctactgacctgacgtacgtaatgcagtggtcaggttgt
tcaactcgatgagaaaaattgggccctacgtaccgtaacgttgcaaattc
agtcggtctagcggatcctactgacctgacgtacgtaatgcagtggtcag
gttgttcaactcgatgactagaatatatccaggaaaatccctggactcat
ccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaa
attcagtcggtacgtttccaggctacacacacactgacagatagacagat
tgtcgtgttatvtgacttggaactgtaggcccttgaatcttggca
  • 1/1,000,000th of the Human Genome
  • Interspersed with genes
  • And polymorphisms which differ between people
  • Are sometimes important, influencing traits
  • or medically important characteristics

25
(No Transcript)
26
DNA basics Mx of sequencing Key to next gen is
massive parallelism and IT Graph with drop in
cost. Use my computer electronics slide Real
promise rsrch, drug targets , need to keep a
realistic focus timeline is long, Impatience to
apply Early applications of Genomic
technology Arrays -Clinical Dx - consumer
application. Slide on DTC with problems. GAO
data. RR. Problems slide Soon sequencing will
supersede arrays Clinical Application real
clinical use will be dx Why? Genetic
heterogeneity examples Public health
application Problems Vast data sets. incidental
info Binning to handle Risky info (reintroduce GE
here) Come back to bin with risk stratification
now revealed. ?Somewhere slide on evidence and
practice (lidocaine) in context of to understand
clinical Sequencing need to understand some
important medical principles like EBM Use the
science not equal to medicine slide. Discourage
genetic exceptionalism in clinical medicine
except where warantedbut were used to dealing
with privat and complex information. Address the
fact that clinical genomic testing is very
different from research. Need focus on
evidence Finish up with ethical challenges,
including IP,
27
  • We have discovered the secret of life

February 28, 1953
About PowerShow.com