Cytochrome c plays an important functional role in the development of Aedes aegypti - PowerPoint PPT Presentation

1 / 22
About This Presentation
Title:

Cytochrome c plays an important functional role in the development of Aedes aegypti

Description:

of molecular pesticides (Aedes aegypti model) Target essential pathways. Programmed ... Molecular pesticide construction. Bioassays. Why Cytochrome C (Cyt C) ... – PowerPoint PPT presentation

Number of Views:337
Avg rating:1.0/5.0
Slides: 23
Provided by: lzh4
Category:

less

Transcript and Presenter's Notes

Title: Cytochrome c plays an important functional role in the development of Aedes aegypti


1
Cytochrome c plays an important functional role
in the development of Aedes aegypti

Liming Zhao, Julia W. Pridgeon, James J. Becnel,
Gary G. Clark and Kenneth J. Linthicum
Mosquito and Fly Research Unit CMAVE, ARS, USDA
2
Research objective
Identify and investigate critical metabolic
pathways in mosquitoes and develop molecular
insecticides to disrupt these pathways
3
Approach for the development of molecular
pesticides
Target essential pathways
Programmed cell death, mitochondria pathway
(Cyt C)
Molecular cloning (mRNA, cDNA, PCR)
(Aedes aegypti model)
Vector, carrier, formulation, microinjection
Molecular pesticide construction
Bioassays
(Aedes aegypti model)
4
Why Cytochrome C (Cyt C)?
  • At center of life in the oxygen-rich world-
    crucial factor in programmed cell death and
    critical for mitochondrial regulation of
    apoptosis
  • Called a type of "moonlighting" protein which has
    one function in one place and an entirely
    different function in another place
  • Many lethal agents target the mitochondria and
    cause release of Cyt C and other pro-apoptotic
    proteins into the cytoplasm
  • Highly conserved protein- found in many
    unicellular and multicellular organisms

5
Studies of Cyt C expressionin Aedes aegypti
  • Developmental regulation
  • Environmental effects on gene expression
  • Ultra violet radiation
  • Temperature
  • Pesticide (permethrin)

6
Tools used in this study
  • 1. Quantitative real-time polymerase chain
    reaction (PCR)
  • 2. Western blot analysis (immunoblot)

7
Developmental regulation of Cyt C
  • Examined Cyt C gene expression during the
    development of Aedes aegypti- stages from eggs to
    adults were collected for RT-PCR analysis
  • Cyt C gene in Aedes aegypti AeaCytC
  • CYTC protein in Aedes aegypti AeaCYTC

8
AeaCytC gene expression level in different
developmental stages
Adults
Egg
1st Instar
2nd Instar
3rd Instar
4th Instar
Pupae
9
Developmental protein expression of AeaCYTC
4th instar larvae
1st instar larvae
early pupae
early adult
late pupae
late adult
late egg
early egg


CYTC
12 KDa
ACTIN
42 KDa
10
Environmental effects on AeaCytC gene expression
  • Ultra-violet radiation light intensity
    (irradiance)
  • 1.003 0.055 mW/cm2
  • Exposure time 0, 15, 30, 180 and 240 min
  • Temperatures 24ºC, 37ºC, 40ºC,
  • relative humidity 56
  • Exposure time 0, 15, 30, and 180 min
  • Permethrin treatment 1.25 x 10-5?g per mosquito
    using acetone as a carrier
  • Exposure time 0, 1, 3, 6, 12 hr

11
AeaCytC gene expression in response to UV
treatments
12
AeaCYTC protein expression in response to UV
treatments
3d Adults
10d Adults
30
0
180
30
0
180 min

CYTC
12 kDa
ACTIN
42 kDa
13
Responses of AeaCytC gene expression to
temperature
14
AeaCYTC protein expression in response to
temperature treatments
24ºC
37ºC
40ºC
30
0
180
0
30
180
0
30
180 min



CYTC
12 KDa
2-day adult
ACTIN
42 KDa

CYTC
12 KDa
9-day adult
ACTIN
42 KDa
15
AeaCytC gene expression in response to permethrin
treatments
16
AeaCYTC protein expression in response to
permethrin treatments
Acetone
Permethrin/acetone
1
0
3
6
12
0
1
3
6
12 hrs




CYTC
12 KDa

3-day adults
ACTIN
42 KDa
CYTC
12 KDa

10-day adults
ACTIN
42 KDa
17
Microinjection for AeaCytC dsRNA



Primers used for the synthesis of dsRNA products




Primer Name
Sequence





TAATACGACTCACTATAGGGATGGGTATTCCAGCTGG

T7-AEACYTC-1F
T7-AEACYTC-327R
TAATACGACTCACTATAGGGTTAGGCGGTAGACGATTTC


T7-AEACYTC-157F
TAATACGACTCACTATAGGGTACA
CAGATGCCAACAAG
TAATACGACTCACTATAGGGGCCTTGTTGGCATCTGTGT

T7-AEACYTC-176R



All primers have a 5 T7 promoter sequence


18
Microinjection for AeaCytC dsRNA
Table 1. Toxicities of dsRNA-AeaCytC products
against female adults of Aedes aegytpi using
microinjection
19
Conclusions I.
  • AeaCytC gene expression much higher in the
    adult Ae. aegypti (especially in teneral adults)
    than in egg, larval and pupal stages
  • AeaCYTC protein can only be detected in adult Ae.
    aegypti
  • AeaCytC relative gene expression increased
    (up-regulated) at 37ºC and 40ºC both in 2 day and
    9 day-old adult after 15 min exposure

20
Conclusions II.
  • AeaCYTC protein is environmentally regulated by
    the age of adults (3 day-old adults may have less
    protection than 10 day-old adults under UV-light
    treatment)
  • dsRNA AeaCytC microinjection of adult Ae. aegypti
    resulting in higher mortality (gt 70) in full
    Length (dsRNA CytC-F) of the gene

21
Acknowledgments
  • Neil Sanscrainte
  • Heather Furlong
  • Lynn Jefferson
  • Nathan Newlon
  • Greg Allen
  • Dr. Ulrich Bernier
  • Dr. Brian Quinn
  • Dr. Chris Geden
  • Dr. Jerry Hogsette
  • Dr. Ken Linthicum
  • Dr. James Becnel
  • Dr. Julia Pridgeon
  • Dr. Gary Clark
  • Dr. Sandra Allan
  • Dr. Dan Kline

Mosquito and Fly Research Unit Center for
Medical, Agricultural, and Veterinary Entomology
ARS, USDA
Dr. Daniel Strickman
National Program Leader, Program 104, USDA-ARS
Deployed War Fighter Protection Research Program
22
Thank you!
Write a Comment
User Comments (0)
About PowerShow.com