Title: Chicken Immunoglobulinbinding proteins: a novel facilitating technology for immunotechnology Michael
1Chicken Immunoglobulin-binding proteinsa novel
facilitating technology for immunotechnologyMic
hael D. Boyle, Ph.D.Von Liebig Chair of
Bio-medical SciencesJuniata College,Huntingdon,
Pennsylvania.In collaboration withBioCheck
Laboratoriesa division of Laboratory Resources,
Inc. BioCheck LaboratoriesToledo, Ohio
2Immunoglobulin binding proteinsa facilitating
technology
Reporter systems based on detecting Fc region
allows a single reagent to be used for
immunotechnological applications that also
utilize the specificity of the antibody combining
region
3Types of immunoassays
- Radio immunoassay
- Enzyme linked immunoassay
- Immunofluorescence
- Fluorescent activated cell sorting
- Affinity purification
- Western blotting
- Immunoelectron microscopy
4Sources of Antibody
- Protein A Protein G
- Rabbit
- Goat
- Human
- Mouse
- Chicken - -
5Why care about chicken antibodies?
- Easy to produce
- Do not require bleeding (egg)
- One chicken can produce a gram of antibody in a
month - Antibodies to highly conserved human proteins can
be produced - Therapeutic antibodies are safe and well
tolerated in the majority of people.
6If chicken antibodies are so useful, why are more
companies not using this system?
- Lack of support technology for measuring and
purifying antibodies. - Historically mouse monoclonal antibodies were
developed rather than the more stable rat
monoclonal antibodies because of the availability
of the screening and purification reagent protein
A.
7Our unique proprietary solution
- Identification of a protein A equivalent molecule
for chicken antibodies - The molecule can be produced rapidly and
economically by recombinant genetic engineering
strategies - A variety of different tracer forms can be
generated for broad applications in
immunotechnology - Protein A and protein G provide a model for
marketing and profitability of such a product.
8Technology edge
- Phase I studies have identified first bacterial
chicken IgY binding protein
9Cloning, Sequencing and Expressing Recombinant
Protein
ATGGCAATTTGTTGGCGTCTTGCTTAGGCGCTGCTTTCTTCTCTTCCTTC
TTAGCTTCAGGTTTTGGAGCTGGAGCTGGTTTAGGTTGAGGTTTTGGCTT
AGGTTCTGGCTTAGGCTCAGGTTTTGGCTCTGGCTTAGGCTCAGGTTTTG
GTTCTGGCTTAGGCTCAGGTTTTGGTTCTGGCTTAGGCTCAGGTTTTGGT
TCTGGCTTAGGCTCAGGTTTTGGTTCTGGCTTAGGCTCAGGTTTAACCTC
TTCGTACACATAAACCACACGAAGATCGCCTTCTAGAGTTGTACCAGTTT
CACTAGGTGAGCCCTCTTGAAGCTTCTTGAACTTGTAGACCTTACCATCT
TTTTCAATCTTATCAAGACGAAGTGAGGTAGTATCGTACGCTTCACCCGG
CAAGCCTTGTGATACCGCAACGGTTTCACCTAAAACATTACCTTCTGTAT
CCACATAAGATACAAGAACGTTAGCATTAAACGGAACAAATTCCCAGTAA
CCGATTAACATGACATCGCCATCACCAGGTGCAACAAAGTTTGATGAAAC
CTTTTCTTCTTTTTCAGAAGATAGAATATTATACCAACCTGCAAATCTCC
ATTCACCAGTTGCAGTCCTTACATTGCTATAGGTTGGCAATTCAATCTTG
TCACCTTTTTTAACAGTTGCAATGTCTGGTAACTTAACAGCATTAAGAAG
TTCTTCTGGTAACAAACGACCTTGATTGCTGCCAAACATGTAAACCACTT
GATTAGTTTCATTAACAAGCGGTTTTGTAATGCCATACTCCCAGTCTTTT
GCCGCTTTAAGCTGTGCTTCTGAAACTACTTCTTCAATTTCAGAAGGCTC
AATTTTTTCTGCAATAGCCTTGCGAACAGAAGCCAGATCTGTTCCAGGAT
ATTGCGCTGCTAAGTTATCAAGCTTAGCATAAGCCTCAGCTCTAG
10Summary of Phase I studies
- Purified an IgY-binding protein
- Developed a tracer form of the protein
- Cloned and sequenced the gene for the protein
- Demonstrated reactivity with chicken, turkey, and
duck antibodies
11Intellectual property position
- The functional activity is unique, non-obvious
and useful. - Utility has been demonstrated
- The sequence defines the activity and affords a
strong IP position - Identifying the domain or subsequence that binds
with functional activity would strengthen
position.
12Target applications
- Diagnostic tests in humans and animals
- Therapeutic antibodies
- Chicken monoclonal antibody technology
development - Research applications in neurobiology and
development - Disease surveillance and vaccine efficacy studies
for the poultry industry
13Market opportunities
- Increased national and international surveillance
for avian influenza provides timely opportunities
for - newly developed immunoassay technology
designed specifically for avian samples.
14Current market opportunity
- Monitoring health in chickens used in food
production - Recent changes in regulation for food exports
- Bioterrorism concerns
- Potential for flu pandemic
15Costs related to avian influenza outbreaks
- The recent outbreak in Italy resulted in 112
million in compensation for destroyed birds, but
it was estimated that the indirect costs of the
outbreak topped 400 million. - A US department of agriculture budgetary item
increase of 12.7 million has been proposed for
increased poultry testing in fiscal year 2005. - The estimated dollars lost to influenza in humans
in the United States rises to over 100 billion
annually. Predicting a potential pandemic from
bird influenza screening-priceless.
16Competitive technologies
- AGID test, is inexpensive with respect to
reagents but is labor intensive, highly
subjective and requires 36 hours to obtain
results. - ELISA test is more sensitive, rapid (providing
results in 3 to 5 hours) and capable of being
automated. The major drawback with this assay is
cost. The retail price for five 96 sample ELISA
plates and reagents to perform the test is 635.
17Investment to date
- Phase I award from Life Sciences Greenhouse of
Central Pennsylvania with match form Juniata
College and Biocheck Laboratories Inc. 145,338. - NIH SBIR phase II award to Biocheck Lab and
Juniata College on a related project.(50,000)
18Current focus of investment
- Identification of functional protein
- Generation of a recombinant form of the protein
- Proof of concept studies
- Securing the basis for a strong intellectual
property position
19Phase II research focus
- To secure optimal patent protection requires
subcloning studies and identification of binding
domains - Demonstration that assay system can successfully
detect avian antibodies to avian influenza with
sufficient sensitivity, specificity and
reproducibility to exceed the capability of
current assays
20Phase II research budget
- The expected budget and timeline for the proposed
phase II studies would be equivalent to the Phase
I investment of - 140,000 and anticipated to be complete within
a 6-9 months.
21The wild card
- All of the focus to date has been on technology
- Is there a market?
- How can the technology transfer be most
effectively achieved? - Who has the expertise to write a business plan?
- Is there a sufficient technology base around
which to form a company? - In the absence of a company structure can
sustaining funding be obtained?
22The trump card
- Immunotechnology is at the core of most
diagnostic testing in humans and animals. - Many false positives in diagnostic testing due to
Fc receptor binding would be eliminated if
chicken antibodies were used. - Therapeutic antibodies have great potential
particularly to treat the consequences of a
bioterrorist attack. - Chicken monoclonal antibody technology has been
developed but is stalled because of absence of
the type of reagents we are developing. - The low cost of antibody production in chickens
and the ability to produce antibodies to highly
conserved mammalian proteins offers profitable
opportunities for custom antibody production.
23Complementing Technologies
- Over the past two decades our laboratory has
- Identified, purified and cloned protein G.
- Identified, purified and cloned a human
IgA-binding protein. - Identified, purified and cloned IgG subclass
specific proteins. - Identified, purified and cloned a human
IgE-binding protein. - Identified and cloned a series of albumin binding
protein. - Identified a rat IgG-binding protein
- Identified a mouse IgA-binding protein.
- Identified and cloned a human plasmin binding
protein. - Developed a unique immunoproteomic platform in
which these reagents can be used for high
throughput proteomics
24Where do we go from here?