Genes and human history - PowerPoint PPT Presentation

1 / 25
About This Presentation
Title:

Genes and human history

Description:

Genes and human history Gil McVean, Department of Statistics, Oxford Contact: mcvean_at_stats.ox.ac.uk – PowerPoint PPT presentation

Number of Views:93
Avg rating:3.0/5.0
Slides: 26
Provided by: mcv71
Category:

less

Transcript and Presenter's Notes

Title: Genes and human history


1
Genes and human history
  • Gil McVean, Department of Statistics, Oxford

Contact mcvean_at_stats.ox.ac.uk
2
(No Transcript)
3
  • Where does the variation come from?
  • How old are the genetic differences between us?
  • Are these differences important?

4
How different are our genomes?
5
Serological techniques for detecting variation
Human
A
6
Blood group systems in humans
  • 28 known systems
  • 39 genes, 643 alleles

System Genes Alleles
ABO ABO 102
Colton C4A, C4B 7
Chido-rodgers AQP1 7
Colton DAF 10
Diego SLC4A1 78
Dombrock DO 9
Duffy FY 9
Gerbich GYPC 9
GIL AQP3 2
H/h FUT1, FUT2 27/22
I GCNT2 7
Indian CD44 2
Kell KEL, XK 33/30
Kidd SLC14A1 8
Knops CR1 24
Landsteiner-Wiener ICAM4 3
Lewis FUT3, FUT6 14/20
Lutheran LU 16
MNS GYPA,GYPB,GYPE 43
OK BSG 2
P-related A4GALT, B3GALT3 14/5
RAPH-MER2 CD151 3
Rh RHCE, RHD, RHAG 129
Scianna ERMAP 4
Xg XG, CD99 -
YT ACHE 4
http//www.bioc.aecom.yu.edu/bgmut/summary.htm
7
Protein electroporesis
  • Changes in mass/charge ratio resulting from amino
    acid substitutions in proteins can be detected
  • In humans, about 30 of all loci show
    polymorphism with a 6 chance of a pair of
    randomly drawn alleles at a locus being different

Starch or agar gel

-
-
-


-
-

-
-
-
-
-
-


-
-
-
Direction of travel
Lewontin and Hubby (1966) Harris(1966)
8
The rise of DNA sequencing
GATAAGACGGTGATACTCACGCGACGGGCTTGGGCGCCGACTCGTTCAGA
CGGTGACCCAACTTATCCGATCGACCCCGGGTCCCGATTTAGACTCGGTA
TCATTTCTGGTGATTATCGCCTGCAGGTTCAAGAACACGTTTGCAGCAAG
AAGTGAGGGATTTTGTCAGTGATCCCAGTCTACGGAGCCAGTCACCTCTG
GTAGTGAAATTTTATTCGTTCATCTTCATATAAGTCGCAGACCGCACGAT
GGGGGACAGAATACTCGCACAGGAAGAACCGCGATGAACCGAGGTAACCT
AACATCCTAAGCCATTCCAACGAGGCTTTCGTAACCAAATCAGTTCTTCC
CAGTCCAGATGAGGCGAACGTAGGTGCTGTTGGAACCATGAGTGGCCAAC
AGAATACTGTGGATGCTAAGCTAATGGAATGTGTTAATCAGACGTTTGCT
GATGTGACACATTGGTCGCTGCTCTTTGATGCGGAAATCTATGAGCGGTC
AAACCGATACAAACCCGGCTATGTCGTTCGCACAACAGTCGGGTCCCACC
CCATTGTTCTTATGAAGGTATTACTGGTCATACGATGCTTTTGCGACGCA
TCCCTCCCTATGACGAGAGTGCAGTCAGACCCCTCGACCATTTCCCTTAG
AAAGACCACCCATCTCTTCAAAGTTATTCTCCGTGACATGCGAACGCTGA
AGGATAAGGAGCGGCATGCAGACTTTTATGTGTGCTCTCTGCTGGTCCAG
CGGCATCTAAACGTCTCATCACTAGGGCCACGCAGTCGTTTTTAAGAGGC
TCTATTTTTACTAATTATTCTTGTCCACCACGACCTCTCAGCGCGGCAGA
TAGGTTCACAGGCTAGCGTCGGGTAATGCATTGCAGTTTCGTTACTCGTT
CAGACAAGACTCGATGCTTTACACTCACGACCCGCAAAGCCTTGGCCTTA
CAAGGGTATTAGGCCGAACACTTACTTATCGCCGAAGGTACGTCGGCTAT
TGTAGCCCAAACCCTAGACTGAGCCCTAACCTCTACGCGTATCTTATAGG
TTCAGAACGCCGAAGGACTATTCTCACGGCATTCATGGTTAAAAGAGAGT
CGAGGCGCCTGCTATATGTGCCGAGTCCCATTAGTCAGTACACTTGCCAT
CACATTTGTCCTGTTAGGCGGACACTTAGAGTAAGCGTACAACGCCTTAC
AACGAGACGCAGATCGCTTTTCTAATTGCGCCGCGTCTCTACCATCGTGG
CCAGTTCATACTCACACGGAGGTGTGCAACCCGTAACACGAGTGAGTGCT
CACTTTATAATAAGTCAGCGTTCAGGACTGAGTGCAACCAATCTACGCCA
GGAATCGCAAACAGCGCTCATAAACTTCTTACCTTTCCATAGCGCGCCTT
TCGAGTATTATTGACCGTTAGGACTACGATAGGCTTCGACAATAGACCCT
ATCTGCGCATCATTACCTCTCACCGGGGGAAAGAAATTCCAATCAATCTG
TCCAGGGCGCCCGTTTTTTTAAGACCTTAGTGCCCATGAATGAACTGGCT
CAAGCAATAGCGGCTGCTCGTGCCATGCGTGAGCTGGCGGCCAAATCGGA
CTCACGGACAAGTCTGCCCCCTTGTGAGTTAGTGTTGGCTTGACAACTCT
AAAGTCCGAACCCATCGTGCGGCCATCCTACGTGGTGTAGCTTTGGCCCA
TAACTAACCTGGTTACTCACTATCCTGCGACTCGTCTGGTCTCACTAGGC
GATTCCCCCCGGCTTCGTATTGCAACATTCTAACGAATGCGAAGTCAAAC
AGTCCAGCTTAACAAAGGGGTCTTGACGAGACTCTGTAATCGTCTGCTAG
CCCCGGACTCTGTTGTCGAAGGCAATTTGACGACCCACACGAGGTGCAGA
CGTAGTCAGGCCTGATAGCTATGTATGCAGGCATATCCCTATAAAGTAGC
GTTTGGTTATCCTACCATTAGCCGTTTCCGCATCTACCAGTGTCGACCGG
9
SNPs
GATAAGACGGTGATACTCACGCGACGGGCTTGGGCGCCGACTCGTTCAGA
CGGTGACCCAACTTATCCGATCGACCCCGGGTCCCGATTTAGACTCGGTA
TCATTTCTGGTGATTATCGCCTGCAGGTTCAAGAACACGTTTGCAGCAAG
AAGTGAGGGATTTTGTCAGTGATCCCAGTCTACGGAGCCAGTCACCTCTG
GTAGTGAAATTTTATTCGTTCATCTTCATATAAGTCGCAGACCGCACGAT
GGGGGACAGAATACTCGCACAGGAAGAACCGCGATGAACCGAGGTAACCT
AACATCCTAAGCCATTCCAACGAGGCTTTCGTAACCAAATCAGTTCTTCC
CAGTCCAGATGAGGCGAACGTAGGTGCTGTTGGAACCATGAGTGGCCAAC
AGAATACTGTGGATGCTAAGCTAATGGAATGTGTTAATCAGACGTTTGCT
GATGTGACACATTGGTCGCTGCTCTTTGATGCGGAAATCTATGAGCGGTC
AAACCGATACAAACCCGGCTATGTCGTTCGCACAACAGTCGGGTCCCACC
CCATTGTTCTTATGAAGGTATTACTGGTCATACGATGCTTTTGCGACGCA
TCCCTCCCTATGACGAGAGTGCAGTCAGACCCCTCGACCATTTCCCTTAG
AAAGACCACCCATCTCTTCAAAGTTATTCTCCGTGACATGCGAACGCTGA
AGGATAAGGAGCGGCATGCAGACTTTTATGTGTGCTCTCTGCTGGTCCAG
CGGCATCTAAACGTCTCATCACTAGGGCCACGCAGTCGTTTTTAAGAGGC
TCTATTTTTACTAATTATTCTTGTCCACCACGACCTCTCAGCGCGGCAGA
TAGGTTCACAGGCTAGCGTCGGGTAATGCATTGCAGTTTCGTTACTCGTT
CAGACAAGACTCGATGCTTTACACTCACGACCCGCAAAGCCTTGGCCTTA
CAAGGGTATTAGGCCGAACACTTACTTATCGCCGAAGGTACGTCGGCTAT
TGTAGCCCAAACCCTAGACTGAGCCCTAACCTCTACGCGTATCTTATAGG
TTCAGAACGCCGAAGGACTATTCTCACGGCATTCATGGTTAAAAGAGAGT
CGAGGCGCCTGCTATATGTGCCGAGTCCCATTAGTCAGTACACTTGCCAT
CACATTTGTCCTGTTAGGCGGACACTTAGAGTAAGCGTACAACGCCTTAC
AACGAGACGCAGATCGCTTTTCTAATTGCGCCGCGTCTCTACCATCGTGG
CCAGTTCATACTCACACGGAGGTGTGCAACCCGTAACACGAGTGAGTGCT
CACTTTATAATAAGTCAGCGTTCAGGACTGAGTGCAACCAATCTACGCCA
GGAATCGCAAACAGCGCTCATAAACTTCTTACCTTTCCATAGCGCGCCTT
TCGAGTATTATTGACCGTTAGGACTACGATAGGCTTCGACAATAGACCCT
ATCTGCGCATCATTACCTCTCACCGGGGGAAAGAAATTCCAATCAATCTG
TCCAGGGCGCCCGTTTTTTTAAGACCTTAGTGCCCATGAATGAACTGGCT
CAAGCAATAGCGGCTGCTCGTGCCATGCGTGAGCTGGCGGCCAAATCGGA
CTCACGGACAAGTCTGCCCCCTTGTGAGTTAGTGTTGGCTTGACAACTCT
AAAGTCCGAACCCATCGTGCGGCCATCCTACGTGGTGTAGCTTTGGCCCA
TAACTAACCTGGTTACTCACTATCCTGCGACTCGTCTGGTCTCACTAGGC
GATTCCCCCCGGCTTCGTATTGCAACATTCTAACGAATGCGAAGTCAAAC
AGTCCAGCTTAACAAAGGGGTCTTGACGAGACTCTGTAATCGTCTGCTAG
CCCCGGACTCTGTTGTCGAAGGCAATTTGACGACCCACACGAGGTGCAGA
CGTAGTCAGGCCTGATAGCTATGTATGCAGGCATATCCCTATAAAGTAGC
GTTTGGTTATCCTACCATTAGCCGTTTCCGCATCTACCAGTGTCGACCGG
Nucleotide
Polymorphisms
Single
TGCATTGCGTAGGC TGCATTCCGTAGGC
1 in 1000 between any two genomes
10
Different, but not that different
  • Humans are one of the least diverse organisms

Species Diversity (percent)
Humans 0.08 - 0.1
Chimpanzees 0.12 - 0.17
Drosophila simulans 2
E. coli 5
HIV1 30
11
c. 3,000,000 SNPs in 270 people
12
c. 25,000,000 SNPs in 1000 people
13
How do we differ? Let me count the ways
  • Single nucleotide polymorphisms
  • Short indels (insertion/deletion)
  • Microsatellite (STR) repeat number
  • Minisatellites
  • Repeated genes
  • rRNA, histones
  • Large inversions, deletions
  • Y chromosome, Copy Number Variants (CNVs)

TGCATTGCGTAGGC TGCATTCCGTAGGC
TGCATT---TAGGC TGCATTCCGTAGGC
TGCTCATCATCATCAGC TGCTCATCA------GC
100bp
1-5kb
14
Y chromosome variation
  • Non-pathological rearrangements of the AZFc
    region on the Y chromosome

15
Where do mutations come from?
  • You will pass on about 60 new mutations to each
    of your children
  • Most of these are destined to die out within a
    few generations
  • Most variation is inherited from our ancestors

16
Me
You
17
Mutations in our ancestors
Our genealogical tree
Our genomes
Inherited mutations
18
mtDNA Eve
19
Recombination means that different parts of the
genome have different tree
  • Looking back in time, recombination means that
    different parts of your chromosomes follow
    different evolutionary paths
  • This means that the genealogical tree will change
    along the genome

Grandmaternal sequence
Grandpaternal sequence
x
TCAGGCATGGATCAGGGAGCT
TCACGCATGGAACAGGGAGCT
TCAGGCATGG
AACAGGGAGCT
20
How old?
21
Human chimp split
Autosomal MRCA
Origin of H. sapiens
22
Homo erectus
23
Australopithecus afarensis
24
Did early humans breed with Neanderthals?
Neanderthals
mtDNA sequences say no
Ovchinnikov et al (2000)
25
Reading
  • Human genetic variation
  • Rosenberg et al. Genetic structure of human
    populations. Science 2002, 2982381-2385.
  • Conrad et al. A worldwide survey of haplotype
    variation and linkage disequilibrium in the human
    genome. Nature Genet. 2006, 1251-1260.
  • McVean et al. Perspectives on human genetic
    variation from the International HapMap Project.
    PLoS Genetics 2005, 1e54.
  • The origin of modern humans
  • Reed Tishkoff. African human diversity,
    origins and migrations. Curr Opin Genet Dev.
    2006 16597-605.
  • Jobling et al. Human evolutionary genetics
    origins, peoples, and disease. Garland Science,
    2004.
  • Harding McVean. A structured ancestral
    population for the evolution of modern humans.
    Curr. Op. Genet. Dev. 2004, 14 667-674.
  • Natural selection
  • Lamason et al. SLC24A5, a putative cation
    exchanger, affects pigmentation in zebrafish and
    humans. Science 2005, 3101782-1786.
  • Sabeti et al. Positive natural selection in the
    human lineage. Science 2006, 3121614-1620.
  • Tishkoff et al. Convergent adaptation of human
    lactase persistence in Africa and Europe. Nat
    Genet. 2007 3931-40
Write a Comment
User Comments (0)
About PowerShow.com