Module 1-1 Bacterial Genetics - PowerPoint PPT Presentation

Loading...

PPT – Module 1-1 Bacterial Genetics PowerPoint presentation | free to download - id: 74f1a7-ZWMzZ



Loading


The Adobe Flash plugin is needed to view this content

Get the plugin now

View by Category
About This Presentation
Title:

Module 1-1 Bacterial Genetics

Description:

Organization of bacterial chromosome Prokaryotic DNA replicate, transcription & translation by Angelia Teo (Jan 09)* – PowerPoint PPT presentation

Number of Views:35
Avg rating:3.0/5.0
Slides: 60
Provided by: Angel296
Learn more at: http://mb206.wikispaces.com
Category:

less

Write a Comment
User Comments (0)
Transcript and Presenter's Notes

Title: Module 1-1 Bacterial Genetics


1
Module 1-1Bacterial Genetics
  • Organization of bacterial chromosome Prokaryotic
    DNA replicate, transcription translation

2
Topics
  • Bacterial chromosome, structure organization
  • Prokaryotic DNA replication, transcription,
    translation
  • Prokaryotic regulation of gene expression
  • Mutations and Selection
  • Extra-chromosomal elements.
  • - Bacteriophages
  • - Plasmid DNA

3
(No Transcript)
4
Prokaryote
  • the genome of prokaryotes is not in a separate
    compartment, haploid. Single chromosome it is
    located in the cytoplasm (although sometimes
    confined to a particular region called a
    nucleoid). Prokaryotes contain no
    membrane-bound organelles their only membrane is
    the membrane that separates the cell form the
    outside world. Nearly all prokaryotes are
    unicellular.

Eukaryotes are defined as having their genetic
material enclosed in a membrane-bound nucleus,
separate from the cytoplasm. In addition,
eukaryotes have other membrane-bound organelles
such as mitochondria, lysosomes, and endoplasmic
reticulum. almost all multicellular organisms
are eukaryotes.
5
Prokaryote cond..
  • Prokaryotes are haploid, and they contain a
    single circular chromosome. In addition,
    prokaryotes often contain small circular DNA
    molecules called plasmids, that confer useful
    properties such as drug resistance. Only
    circular DNA molecules in prokaryotes can
    replicate.

Eukaryotes are often diploid, and eukaryotes have
linear chromosomes, usually more than 1.
6
Prokaryote cond..
  • In prokaryotes, translation is coupled to
    transcription translation of the new RNA
    molecule starts before transcription is finished.

In eukaryotes, transcription of genes in RNA
occurs in the nucleus, and translation of that
RNA into protein occurs in the cytoplasm. The
two processes are separated from each other.
7
Bacteria
  • Bacteria review
  • one-celled organisms
  • prokaryotes
  • reproduce by mitosis
  • binary fission
  • rapid growth
  • generation every 20 minutes
  • 108 (100 million) colony overnight!
  • dominant form of life on Earth
  • incredibly diverse

8
Bacterial genome
  • Single circular chromosome
  • haploid
  • naked DNA
  • no histone proteins
  • 4 million base pairs
  • 4300 genes
  • 1/1000 DNA in eukaryote

9
No nucleus!
  • No nuclear membrane
  • chromosome in cytoplasm
  • transcription translation are coupled together
  • no processing of mRNA
  • no introns
  • but Central Dogma still applies
  • use same genetic code

10
Bacterial Chromosome
  • Molecules of double-stranded DNA
  • Usually circular
  • Tend to be shorter
  • Contains a few thousand unique genes
  • Mostly structural genes
  • Single origin of replication

11
Bacterial Chromosome cond..
  • The bacterial chromosome is found in region
    called the nucleoid (not membrane-bounded- so the
    DNA is in direct contact with the cytoplasm)

12
(No Transcript)
13
(No Transcript)
14
(No Transcript)
15
Bacterial Chromosome cond..
Bacterial Genome is haploid, single chromosome
  • The circularity of the bacterial chromosome was
    elegantly demonstrated by electron microscopy in
    both Gram negative bacteria (such as Escherichia
    coli) and Gram positive bacteria (such as
    Bacillus subtilis).
  • Bacterial plasmids were also shown to be
    circular.
  • Linear chromosomes found in Gram-positive
  • Borrelia Streptomyces.

Not all bacteria have a single circular
chromosome some bacteria have multiple circular
chromosomes, and many bacteria have linear
chromosomes and linear plasmids.
16
Bacterial Chromosome cond..
  • Bacterial chromosomal DNA is usually a circular
    molecule that is a few million nucleotides in
    length
  • Escherichia coli ? 4.6 million base pairs
  • Haemophilus influenzae ? 1.8 million base pairs
  • A typical bacterial chromosome contains a few
    thousand different genes
  • Structural gene sequences (encoding proteins)
    account for the majority of bacterial DNA
  • The nontranscribed DNA between adjacent genes are
    termed intergenic regions

17
Chromosome of E. coli
18
Chromosomal Map of Bacteria
Circular genetic map of E coli. Positions of
representative genes are indicated on inner
circle. Distances between genes are calibrated in
minutes, based on times required for transfer
during conjugation. Position of threonine (thr)
locus is arbitrarily designated as 0 minutes, and
other assignments are relative to thr.
19
The Complete Sequence of Escherichia coli
Chromosome
20
Key features of bacterial chromosomes
21
(No Transcript)
22
Compaction
  • Typical bacterial chromosome must be compacted
    about 1,000-fold
  • Bacterial DNA is not wound around histone
    proteins to form nucleosomes
  • Proteins important in forming loop domains
  • Compacts DNA about 10-fold
  • DNA supercoiling
  • Topoisomerases twist the DNA and control degree
    of supercoiling

23
(No Transcript)
24
(No Transcript)
25
(No Transcript)
26
Comparison of a gene in bacteria
  • The length of a typical bacterial operon (usually
    about 3 genes), is about as long as the entire
    bacterial cell !

27
(No Transcript)
28
The Operon Model
The position that a given gene occupies on a
chromosome
The operon model of prokaryotic gene regulation
was proposed by Fancois Jacob and Jacques Monod.
Groups of genes coding for related proteins are
arranged in units known as operons. An operon
consists of an operator, promoter, regulator, and
structural genes. The regulator gene codes for a
repressor protein that binds to the operator,
obstructing the promoter (thus, transcription) of
the structural genes. The regulator does not have
to be adjacent to other genes in the operon. If
the repressor protein is removed, transcription
may occur.
29
The Operon Model
Operons are either inducible or repressible
according to the control mechanism. Seventy-five
different operons controlling 250 structural
genes have been identified for E. coli. Both
repression and induction are examples of negative
control since the repressor proteins turn off
transcription.
30
The Operon Model
31
Extra-chromosomal Elements
  • DNA molecules that replicate as discrete genetic
    units in bacteria are called replicons.
  • Extrachromosomal replicons
  • - bacteriophages
  • - plasmids (non-essential replicons)
  • These determine resistance to antimicrobial
    agents or production of
  • virulence factors.

32
(No Transcript)
33
  • Bacteriophage (from 'bacteria' and Greek f??e??
    phagein "to eat")
  • is any one of a number of viruses that infect
    bacteria. The term is commonly used in its
    shortened form, phage.

34
A plasmid is an extra-chromosomal DNA molecule
separate from the chromosomal DNA which is
capable of replicating independently of the
chromosomal DNA. In many cases, it is circular
and double-stranded. Plasmids usually occur
naturally in bacteria, but are sometimes found in
eukaryotic organisms.
35
(No Transcript)
36
Bacteria genetics
37
Bacteria have 4 important advantages for
"traditional types of genetic experiments
38
Genetic material in Bacteria
39
Thank U!!!
40
Nucleic Acid
41
(No Transcript)
42
Nucleic Acid (DNA RNA)
  • Nucleic acids are polynucleotides, consist of
    repeating nucleotide units
  • Each nucleotide contains one phosphate group, one
    sugar (pentose
  • or deoxypentose) and one base (purine or
    pyrimidine).
  • Phosphodiester bonds link the 3'-OH of one
    nucleotide sugar to the
  • 5'-OH group of the adjacent nucleotide
    sugar.
  • In DNA the sugar is D-2-deoxyribose in RNA the
    sugar is D-ribose.
  • RNA has a hydroxyl group on the 2' carbon of
    the sugar.
  • In DNA the purine bases are adenine (A) and
  • guanine (G), and the pyrimidine bases are
    thymine
  • (T) and cytosine (C).
  • In RNA, uracil (U) replaces thymine.
  • Chemically modified purine and pyrimidine bases
  • are found in some bacteria and
    bacteriophages.

43
Nucleic Acid Structure
  • DNA is a double-stranded helix two strands are
    anti-parallel.
  • Double helix is stabilized by H bonds between
    purine pyrimidine bases on the opposite
    strands. A pairs T by 2 H bonds G pairs C by 3
    H bonds.
  • Two strands in DNA helix are complementary, ie.
    dsDNA contains equimolar amounts of purines (A
    G) and pyrimidines (T C), with A T and G C.
  • The mole fraction of G C in DNA varies
    widely among different bacteria.
  • DNA is supercoiled and tightly packaged.
  • The extent of sequence homology between DNAs from
    different microorganisms determines how closely
    related they are (eg. 16sRNA sequence)
  • RNA exists as a single-stranded molecule forms
    hairpin loops (secondary structure) due to
    intra-molecular base-pairing.

44
  • DNA Replication in Bacteria
  • The DNA replicates semiconservatively
  • - Each strand in dsDNA serves as a
  • template for synthesis of a new
  • complementary strand.
  • - Result daughter dsDNA molecule -
  • contains one old polynucleotide strand
  • and one newly synthesized strand.
  • Replication of chromosomal DNA in
  • bacteria starts at a specific chromosomal
  • site called the origin of replication and
  • proceeds bi-directionally until the process is
  • completed.

Autoradiograph of intact replicating chromosome
of E coli. Bacteria were radioactively labeled
with tritiated thymidine
X
Y
.
45
  • DNA Replication in Bacteria
  • DNA replication is initiated whenever cells
    divide, so in rapidly
  • growing bacteria a new round of chromosomal
    replication begins
  • before an earlier round is completed.
  • The origin regions specifically and transiently
    associate with
  • the cell membrane after initiation of DNA
    replication. Membrane
  • attachment directs separation of daughter
    chromosomes.
  • Time required for replication of the entire
    chromosome is
  • about 40 minutes (500 1000 nucleotides /
    sec)
  • Replicated chromosomes are partitioned into
    each of the
  • daughter cells.

46
(No Transcript)
47
Central Dogma of Molecular Biology How does the
sequence of a strand of DNA correspond to the
amino acid sequence of a protein?  
  • DNA codes for RNA production.
  • RNA codes for protein production.
  • Protein does not code protein, RNA
  • or DNA production.
  • The end.
  • Or in the words of Francis Crick Once
    information has passed into
  • protein, it cannot get out again!

48
  • Revision of the "Central Dogma"
  • CAN go back from RNA to DNA (reverse
    transcriptase)
  • RNA can also make copies of itself (RNA
    polymerase)
  • Still NOT possible from Proteins back to RNA or
    DNA
  • Not known mechanisms for proteins making copies
    of themselves.

49
(No Transcript)
50
  • Gene Expression
  • Expression of genetic determinants in bacteria
    involves the
  • unidirectional flow of information from DNA to
    RNA to
  • protein.
  • Two processes involved are transcription and
    translation.

 
51
Transcription Translation Prokaryotic vs
Eukaryotic cells In a prokaryotic cell, which
does not contain a nucleus, this process happens
at the same time. In Eukaryotic cells, occur at
different cell compartments.
Prokaryotic cell
Eukaryotic cell
52
  • Transcription
  • The DNA-directed synthesis of RNA is called
    transcription.
  • Transcription produces RNA molecules that are
    complimentary
  • copies of one strand of DNA.
  • Only one of the dsDNA strands can serve as
    template for
  • synthesis of a specific mRNA molecule.
  • mRNAs transmit information from DNA, and each
    mRNA in
  • bacteria function as a template for synthesis
    of one or more
  • specific proteins.

53
  • Translation
  • The process by which the nucleotide sequence of
    an mRNA molecule
  • determines the primary amino acid sequence of
    a protein.
  • Ribosomes are complexes of ribosomal RNAs
    (rRNAs) and several
  • ribosomal proteins.
  • Ribosomes with the aid of transfer RNAs
    (tRNAs), amino-acyl tRNA
  • synthesases, initiation factors and elongation
    factors are all involved in
  • translation of each mRNA into corresponding
    polypeptide (protein).

54
  • Translation
  • Initiated at an AUG codon for methionine.
  • Codons are translated sequentially in mRNA from
    5' to 3'.
  • The corresponding polypeptide chain / protein is
    assembled
  • from the amino terminus to carboxy terminus.
  • The sequence of amino acids in the polypeptide
    is, therefore,
  • co-linear with the sequence of nucleotides in
    the mRNA and the
  • corresponding gene.

55
  • The Genetic code
  • The "universal" genetic code employed by most
    organisms is a triplet code and it determines how
    the nucleotides in mRNA specify the amino acids
    in the polypeptide.
  • 61 of 64 possible trinucleotides (codons) encode
    specific amino acids.
  • 3 remaining codons (UAG, UAA or UGA) code for
    termination of translation (nonsense codons do
    not specify any amino acids)
  • Exceptions
  • UGA as a tryptophan codon in some species of
    Mycoplasma and in mitochondrial DNA.
  • Few codon differences in mitochondrial DNAs from
    yeasts, Drosophila, and mammals.

56
Gene expression occurs in 2 steps Transcription
of the information encoded in DNA into a molecule
of RNA Translation of the information encoded in
mRNA into a defined sequence of amino acids in a
protein.
57
Tutorial
  • The sequence of one strand of DNA is
  • 5 GGGTAAGCTTATCCCGTA 3
  • 3 CCCATTCGAATAGGGCAT 5
  • The sequence of the complementary strand from 5
    to 3 is
  • A) CCCATTCGAATAGGGCAT
  • B) TACGGGATAAGCTTACCC
  • C) GGGTAAGCTTATCCCGTA
  • D) ATGCCCTATTCGAATGGG

58
  • The following is the sense strand of the DNA
    sequence. Give the amino acid sequence of the
    protein generated
  • after translation.
  • 5 ATGGGGTACTACCATCCCAATCATCCCAATAGGTACCCC 3
  • TRANSCRIPTION
  • 5 AUGGGGUACUACCAUCCCAAUCAUCCCAAUAGGUACCCC 3
  • TRANSLATION
  • Met Gly Tyr Tyr His Pro Asn
    His Pro Asn Arg Tyr Pro
  • 5AUG GGG UAC UAC CAU CCC AAU CAU
    CCC AAU AGG UAC CCC 3

59
References
  • Charlebois, R. 1999. Organization of the
    Prokaryotic Genome. ASM Press, Washington, D.C.
  • Casjens, S. 1998. The diverse and dynamic
    structure of bacterial genomes. Ann. Rev. Genet.
    32 339-377.
  • Casjens, S. 1999. Evolution of the linear DNA
    replicons of the Borrelia spirochetes. Curr.
    Opin. Microbiol. 2 529-534.
  • Chen, C. 1996. http//www.ym.edu.tw/ig/cwc/end_tro
    ubles/End_Troubles.html
  • Jumas-Bilak et al. 1998. Unconventional genomic
    organization in the alpha subgroup of the
    Proteobacteria. J. Bacteriol. 180 2749-2755.
  • Kobryn K, Chaconas G. 2001. The circle is broken
    telomere resolution in linear replicons. Curr
    Opin Microbiol. 4(5) 558-564.
  • Suwanto, A., and S. Kaplan. 1989. Physical and
    genetic mapping of the Rhodobacter sphaeroides
    2.4.1 genome presence of two unique circular
    chromosomes. J. Bacteriol. 171 5850-5859.
  • Suwanto, A and S. Kaplan. 1992. Chromosome
    transfer in Rhodobacter sphaeroides Hfr
    formation and genetic evidence for two unique
    circular chromosomes. J. Bacteriol. 174
    1135-1145.
  • Trucksis et al. 1998. The Vibrio cholerae genome
    contains two unique circular chromosomes. Proc.
    Natl. Acad. Sci. USA 95 14464-14469.
  • Volff, J.-N., and J. Altenbuchner. 2000. A new
    beginning with new ends linearisation of
    circular chromosomes during bacterial evolution.
    FEMS Microbiol. Lett. 186 143-150.
  • Yang CC, Huang CH, Li CY, Tsay YG, Lee SC, Chen
    CW. 2002. The terminal proteins of linear
    Streptomyces chromosomes and plasmids a novel
    class of replication priming proteins. Mol
    Microbiol. 43(2) 297-305.
About PowerShow.com