A New Breed

1
Interest Grabber
Ch. 13-Genetic Engineering-Section 1
Section 13-1

• A New Breed
• The tomatoes in your salad and the dog in your
• backyard are a result of selective breeding. Over
• thousands of years, humans have developed breeds
• of animals and plants that have desirable
  characteristics. How
• do breeders predict the results of crossing
  individuals with
• different traits?
• On the next slide, work with a partner. Pick two
  breeds of dogs
• and give 4 characteristics for each. In the
  middle green circles,
• list those characteristics you might see if you
  bred the two
• dogs together.

2
(No Transcript)
3
Ch. 13-Genetic Engineering-Section 1
131 Changing the Living World A. Selective
Breeding Hybridization-Zorses, wholphins,
tigons, and beefaloes. Lepjags, zonkeys, camas,
and bonanzees. These are some of the captive-bred
mammalian hybrids that exist, and they're joined
by a host of hybrid birds, fish, insects, and
plants. Thanks to new techniques that allow
scientists to isolate and compare DNA, more
hybrids are turning up every year, and we're
learning that some of themsuch as the pizzly, a
cross between a polar bear and a grizzlycan
occur naturally in the wild.
4
Ch. 13-Genetic Engineering-Section 1
2. Inbreeding There are over 350 known,
inherited diseases among purebred dogs, and
that's pretty scary,'' said Alison Schaffer, a
researcher at the University of California at
Davis' Veterinary Genetics Laboratory.
http//www.upei.ca/cidd/intro.htm Link to
Canine inherited disorders database
5
Ch. 13-Genetic Engineering-Section 1
B. Increasing Variation Scientists and breeders
can increase the genetic variation in a
population by inducing mutations 1.Producing New
Kinds of Bacteria a. Oil eating bacteria 2.
Producing New Kinds of Plants a. Polyploidy
i. Durham semolina wheat ii. Bananas iii.
Citrus fruits
6
Concept Map
Ch. 13-Genetic Engineering-Section 1
Section 13-1
Selective Breeding
consists of
which crosses
which crosses
for example
for example
which
which
7
Ch. 13-Genetic Engineering-Section 2
The Smallest Scissors in the World Have you ever
used your word processors Search function? You
can specify a sequence of letters, whether it is
a sentence, a word, or nonsense, and the program
scrolls rapidly through your document, finding
every occurrence of that sequence. How might such
a function be helpful to a molecular biologist
who needs to search DNA for the right place to
divide it into pieces?
8
Ch. 13-Genetic Engineering-Section 2
1. Copy the following series of DNA nucleotides
onto a sheet of paper. GTACTAGGTTAACTGTACTATCGTT
AACGTAAGCTACGTTAACCTA 2. Look carefully at the
series, and find this sequence of letters
GTTAAC. It may appear more than once. 3. When
you find it, divide the sequence in half with a
mark of your pencil. You will divide it between
the T and the A. This produces short segments of
DNA. How many occurrences of the sequence GTTAAC
can you find?
9
Ch. 13-Genetic Engineering-Section 2

• 132 Manipulating DNA
• Scientists use their knowledge of the structure
  of DNA and its chemical properties to study and
  change DNA molecules.
• A. The Tools of Molecular Biology
• DNA Extraction-interactive link
• http//learn.genetics.utah.edu/units/biotech/extra
  ction/
• 2. Cutting DNA-restriction enzymes-interactive
  link
• http//www3.interscience.wiley.com8100/legacy/col
  lege/boyer/0471661791/animations/agarose/agarose.h
  tm
• 3. Separating DNA-interactive link
• http//learn.genetics.utah.edu/units/biotech/gel/

10
Ch. 13-Genetic Engineering-Section 2
B. Using the DNA Sequence If scientists can
figure out the sequence then they can use this
knowledge to diagnose disease and to change the
DNA. 1. Reading the Sequence interactive
link http//www.pbs.org/wgbh/nova/genome/sequencer
.html 2. Cutting and Pasting-recombinant DNA
video http//www.present.udel.edu/biotech/rDNA.htm
l 3. Making Copies-interactive Polymerase Chain
reaction http//lifesciences.envmed.rochester.edu
/movies/PCR_final.swf
11
Ch. 13-Genetic Engineering-Section 3
Sneaking In You probably have heard of computer
viruses. Once inside a computer, these programs
follow their original instructions and override
instructions already in the host computer.
Scientists use small packages of DNA to sneak
a new gene into a cell, much as a computer virus
sneaks into a computer.
12
Ch. 13-Genetic Engineering-Section 3
1. Computer viruses enter a computer attached to
some other file. What are some ways that a file
can be added to a computers memory? 2. Why
would a person download a virus program? 3. If
scientists want to get some DNA into a cell, such
as a bacterial cell, to what sort of molecule
might they attach the DNA?
13
Ch. 13-Genetic Engineering-Section 3
133 Cell Transformation During transformation, a
cell takes in DNA from outside the cell. This
external DNA becomes a component of the cell's
DNA. A. Transforming Bacteria-interactive
link-choose techniques http//www.dnai.org/b/in
dex.html B. Transforming Plant
Cells-interactive link. scroll down and view
Gene Gun http//plantandsoil.unl.edu/croptechnol
ogy2005/gen/?whatanimationList C. Transforming
Animal Cells-same as plants
14
Ch. 13-Genetic Engineering-Section 4
The Good With the Bad The manipulation of DNA
allows scientists to do some interesting things.
Scientists have developed many transgenic
organisms, which are organisms that contain genes
from other organisms. Recently, scientists have
removed a gene for green fluorescent protein from
a jellyfish and tried to insert it into a monkey.

15
Ch. 13-Genetic Engineering-Section 4
1. Transgenic animals are often used in
research. What might be the benefit to medical
research of a mouse whose immune system is
genetically altered to mimic some aspect of the
human immune system? 2. Transgenic plants and
animals may have increased value as food sources.
What might happen to native species if transgenic
animals or plants were released into the wild?
16
Ch. 13-Genetic Engineering-Section 4
134Applications of Genetic Engineering The
universal nature of genetic mechanisms makes it
possible to construct organisms that are
transgenic, meaning that they contain genes from
other species. A. Transgenic Organisms 1.
Transgenic Microorganisms-insulin, HGH,
Blood- clotting factor. 2. Transgenic
Animals-grow faster and leaner 3.Transgenic
Plants-make their own pesticides B. Cloning-may
help save endangered species