Basic%20techniques - PowerPoint PPT Presentation

View by Category
About This Presentation
Title:

Basic%20techniques

Description:

Basic techniques--- Nucleic acid hybridization complementary strands will associate and form double stranded molecules--- Restriction Enzymes These enzymes recognize ... – PowerPoint PPT presentation

Number of Views:50
Avg rating:3.0/5.0
Slides: 122
Provided by: Rohin1
Category:

less

Write a Comment
User Comments (0)
Transcript and Presenter's Notes

Title: Basic%20techniques


1
Basic techniques
--- Nucleic acid hybridization complementary
strands will associate and form double stranded
molecules --- Restriction Enzymes These enzymes
recognize and cleave DNA at specific
sequences --- Blotting Allows analysis of a
single sequence in a mixture --- DNA
cloning This allows the isolation and generation
of a large number of copies of a given DNA
sequence --- DNA sequencing Determining the
array of nucleotides in a DNA molecule --- PCR a
mplification of known sequence --- Transformation
Stably integrating a piece of DNA into the
genome of an organism --- Genetic
engineering Altering the DNA sequence of a given
piece of DNA --- Genomics Analyzing changes in
an entire genome
2
Nucleic acid hybridization
Complementary strands of DNA or RNA will
specifically associate DNA is heated to 100C,
the hydrogen bonds linking the two strands are
broken The double helix dissociates into single
strands. As the solution is allowed to cool,
strands with complementary sequences readily
re-form double helixes. This is called Nucleic
acid hybridization. 5 AAAAAAAATTTTAAAAAAA
3 Will associate with 3 TTTTTTTTAAAATTTTTTT
5 This occurs with complementary DNA/DNA,
DNA/RNA, RNA/RNA
3
Li-Fraumeni syndrome
This technique is very sensitive and specific. A
single 200 nucleotide sequence when added to a
solution of a million sequences will
specifically hybridize with the ONE
complementary sequence
Usefulness Li-Fraumeni syndrome Individuals in a
family have a propensity to develop tumors at an
early age Often these families have a deletion
in the p53 gene When this family has a child,
they might want to know if their child has
normal p53 or not Nucleic acid hybridization
provides a means to rapidly determine whether
the sequence is present or not
4
Sequencing
Reference Genome- Number of donor DNAs are
sequenced Consensus sequence is reference
genome Pieces of DNA are sequenced many
times Computers are used to overlap the pieces
to generate contigs Sequences of individuals
will vary from the reference genome
5
The method
Isolate DNA Patient
Isolate DNA normal individual
(The probe)
Fragment DNA, Heat to denature Add radiolabeled
ssDNA(p53 probe) Gradually and slowly cool
solution
p53 probe is unable to associates with DNA of
patient (gene absent)
Radiolabeled p53 probe associates with DNA in
normal individual
Add enzyme (nuclease) that specifically
degrades ssDNA molecules. dsDNA remains.
No radiolabel present in dsDNA (because p53 probe
could not anneal)
Radiolabel present in dsDNA
Extremely sensitive p53 is 3000bp, human genome
is 3000,000,000 bp Technique detects one sequence
of 3000bp from 1 million sequences of 3000bp
6
The method
Isolate DNA
normal individual
Patient
Fragment DNA, Heat to denature Add radiolabeled
ssDNA (p53 gene) (p53 probe) Gradually and
slowly cool solution
Radiolabeled p53 probe associates with DNA in
normal individual
If patient is deficient for p53 gene
Radiolabeled p53 probe is unable to associates
with DNA in patient
Add enzyme (nuclease) that specifically
degrades ssDNA molecules. dsDNA remains degraded
No radiolabel present in dsDNA (because p53 probe
could not anneal)
Radiolabel present in dsDNA
7
THE GENE PROBE!!!
How do we isolate the GENE? How did we get a
pure copy of the gene?
8
Restriction Enzymes
Enzymes which cut DNA at specific
sequences SmaI 5
AAAACCCGGGAAAA3 3 TTTTGGGCCCTTTT5
This sequence is symmetrical. If one rotates
it about the axis It reads the same
5 AAAAGAATTCAAAA3 3
TTTTCTTAAGTTTT5
EcoRI
9
Restriction enzymes
Restriction enzyme digestion of DNA (linear
genomic double stranded DNA) OR Restriction
enzyme digestion of bacterial plasmid DNA (small
double stranded circular DNA) No digestion
of RNA No digestion of single stranded DNA
10
Blunt Vs Sticky
Blunt ends Sticky ends
11
Restriction sites
SmaI
5AAAAAAAAAAGGGGGGGGTTTTTTTCCCGGGAAAAAAAAGGGGGGGGT
TTTTT3 3TTTTTTTTTTCCCCCCCCAAAAAAAGGGCCCTTTTTTTTC
CCCCCCCAAAAAA5
5AAAAAAAAAAGGGGGGGGTTTTTTTCCC
GGGAAAAAAAAGGGGGGGGTTTTTT3 3TTTTTTTTTTCCCCCCCCAA
AAAAAGGG CCCTTTTTTTTCCCCCCCCAAAAAA5
EcoRI is another commonly used restriction enzyme
5AAAAAAAAAAGGGGGGGGTTTTTTTGAATTCAAAAAAAAGGGGGGGGT
TTTTT3 3TTTTTTTTTTCCCCCCCCAAAAAAACTTAAGTTTTTTTTC
CCCCCCCAAAAAA5
5AAAAAAAAAAGGGGGGGGTTTTTTTG
AATTCAAAAAAAAGGGGGGGGTTTTTT3 3TTTTTTTTTTCCCCCCCC
AAAAAAACTTAA GTTTTTTTTCCCCCCCCAAAAAA5
Unlike SmaI which produces a blunt end, EcoRI
produces sticky or cohesive ends (SINGLE
STRANDED) These cohesive ends facilitate
formation of recombinant DNA molecules
12
Linear/Circular DNA
A linear DNA molecule with ONE SmaI site will be
cut into two fragments
A circular DNA molecule with ONE SmaI site will
generate one DNA fragment
13
5AAAAAAAAAAGGGGGGGGTTTTTTTGAATTCAAAAAAAAGGGGGGGGT
TTTTT3 3TTTTTTTTTTCCCCCCCCAAAAAAACTTAAGTTTTTTTTC
CCCCCCCAAAAAA5
5AAAAAAAAAAGGGGGGGGTTTTTTTG
AATTCAAAAAAAAGGGGGGGGTTTTTT3 3TTTTTTTTTTCCCCCCCC
AAAAAAACTTAA GTTTTTTTTCCCCCCCCAAAAAA5
5AAAAAAAAAAGGGGTTTTTTTG AATTCAAAAAAAAAAAAAAGG
GGGGGGTTTTTTTG AATTCAAAAAAAAGGGGGGGGTTTTTT3 3
TTTTTTTTTACCCCAAAAAAACTTAA
GTTTTTTTTTTTTTTCCCCCCCCAAAAAAACTTAA
GTTTTTTTTCCCCCCCCAAAAAA5
14
Complementary sticky ends
AATTCAAAAAAAAGGGGGGGGTTT3 GTTTTTTTTCCCCCCCCAA
A5
AAAAAAGGGGGGGGTTTTTTTG TTTTTTCCCCCCCCAAAAAAACTTAA
AATTCAAAAAAAAGGGGGGGGTTT3 GTTTTTTTTCCCCCCCCAA
A5
AAAAAAGGGGGGGGTTTTTTTG TTTTTTCCCCCCCCAAAAAAACTTAA
GGCCCAAAAAAAAGGGGGGGGTTT3 GTTTTTTTTCCCCCCCCAA
A5
AAAAAAGGGGGGGGTTTTTTTG TTTTTTCCCCCCCCAAAAAAACTTAA
15
Enzyme compatibility
SmaI AAACCCGGGAAA XmaI AAACCCGGGAAA TTTGGGCCCTTT
TTTGGGCCCTTT
EcoRI AAAGAATTCAAA MfeI AAACAATTGAAA TTTCTTAAGTTT
TTTGTTAACTTT
KpnI AAAGGTACCAAA Asp718 AAAGGTACCAAA TTTCCATGGTT
T TTTCCATGGTTT
16
Restriction maps
Restriction maps are descriptions of the number,
type and distances between Restriction sites on
a piece of DNA. Very useful for molecular
biologists. Previously we used specific genes as
markers on chromosome and Map units to indicate
distance between the markers. Its like using
specific landmarks to identify your location
along a road. Restriction sites are also used as
landmarks along a piece of DNA.
Vg
Pr
3kb
205kb
300kb
4kb
PstI
EcoRI
SmaI
BamHI
HindIII
AAAAAAAAAAAAGAATTCTTTTTT//TTTTTTTTAAGCTTCCCCCC//CC
CCCCCTGCAGGGGGGGGGCCCGGGAAAAAAAA TTTTTTTTTTTTCTTAA
GAAAAAA//AAAAAAAATTCGAAGGGGGG//GGGGGGGACGTCCCCCCCC
CGGGCCCTTTTTTTT
Restriction sites CAN serve as MARKERS ALONG the
DNA. They can be used to generate a physical map
of a specific DNA sequence can be created.
17
Drosophila Genome is 123 million bp long There
are 15,000 genes (markers) Every gene marker is
on average approximately 8000bp apart EcoRI
sites are on average 4000bp apart HinDIII sites
are on average 4000bp apart Etc etc There are
many more landmarks on any one piece of DNA
18
Sequence Divergence
The restriction map is a partial picture of the
nucleotide sequence of a gene By comparing
restriction maps we can surmise differences in
the sequence between species
NNNNNNNNGAATTCNNNNNNNN//NNNNNNNNAAGCTTNNNNNNNNNNNN
NNCTGCAGNNNNNNNNNNNNNNN NNNNNNNNCTTAAGNNNNNNNN//NN
NNNNNNTTCGAANNNNNNNNNNNNNNGACGTCNNNNNNNNNNNNNNN
GeneA
Mai California may rahta hu aur UCSC may padhata
hu.
19
Deletions and additions
Normal Globin gene
3
5
8
4
EcoRI
EcoRI
EcoRI
HindIII
HindIII
Globin gene from a thallesimia patient
3
5
3
4
EcoRI
EcoRI
EcoRI
HindIII
HindIII
With restriction maps, the relationship between a
gene from two different individuals can be
determined without having to actually sequence
the gene from both individuals.
20
Very Large deletions or insertions can be studied
using microscopy Small to large
deletions/insertions (100 bp to several kb) can
be studied using restriction maps
21
Restriction map
Describing a DNA piece based on the pattern of
restriction sites Restriction map of a cloned
piece of DNA Linear or circular
How do I do this for an unknown piece of DNA?
22
Analogy
1
2
Identify the parts for this blob and describe the
spatial relationship between the parts
a
c
a
3
c
4
b
b
Break the blob apart into its separate parts Look
at the shapes and numbers of the parts Fit the
parts together
23
Method
Restriction map of piece of DNA Large amount of
pure DNA (many copies of the same DNA is
required) (Cloned) Then you digest the DNA Take
(cloned) DNA in a tube, Add restriction enzyme,
Allow enzyme to cut DNA at its binding
sites Run the digested DNA on a gel to resolve
the DNA fragments based on size Piece the
fragments together to determine the linear order
of the fragments (build the map)
24
Gel electrophoresis
Agarose gel electrophoresis The length of the
DNA can be accurately determined by allowing the
charged DNA to run through an agarose gel. DNA
is an anion (-ve charged) and moves towards the
Positive anode. The rate of migration of a DNA
fragment is inversely proportional to its
size. Larger the size, slower its movement.
EcoRI/HindIII
HindIII
Marker
EcoRI
7
5
4
3
2
1
25
Mapping
You are given a 20 kb fragment of DNA After
trying many enzymes you find that EcoRI and
HindIII cut the fragment
HindIII 14kb and 6kb EcoRI 12kb 6kb and
2kb Solve the map
Or its mirror image
They are the same
What about EcoRI?
E
E
How do you arrange these three fragments wrt one
another
26
Mapping
Since HindIII cut the 20kb fragment once, in
which of the three EcoRI fragment does it
cut? A double digest with both enzymes will
provide the answer
Fragments of 8kb, 6kb, 4kb and 2kb The double
digest does not alter the size of the 6kb and
2kb fragments The 12kb fragment is lost. Also
8412
EcoRIHindIII
HindIII
Marker
EcoRI
14
12
8
6
2
6
12
4
4
2
H
6
2
E
E
8
4
1
Partial Map only!!!! Not enough information
27
New Mapping
How are these fragments ordered?
The HindIII single digest tells us that they must
be ordered so that One side adds up to 6kb and
the other side adds up to 14kb
EcoRI HindIII
HindIII
Marker
EcoRI
14
12
6
4
2
1
28
Mapping
HindIII EcoRI HindIII/EcoRI 14 12 8 6 6 6
4 2 2
29
Mapping
HindIII EcoRI HindIII/EcoRI 14 12 8 6 6 6
4 2 2
30
Different Mapping example
Hi Ec Hi/Ec 12 12 8 8 6 6 4 2 2
Ps Ps/Ec 13 12 7 5 2 1
Three different enzymes Hi Ec Ps
31
Mapping
HindIII EcoRI HindIII/EcoRI 12 12 8 8 6 6
4 2 2
HindIII
12 8
12 8
32
Mapping
HindIII EcoRI HindIII/EcoRI 12 12 8 8 6 6
4 2 2
HindIII
12 8
4
8
12 8
2
6
12
33
Mapping
EcoRI PstI PstI/EcoRI 12 13 12 6 7 5 2 2
1
34
Mapping
EcoRI PstI PstI/EcoRI 12 13 12 6 7 5 2 2
1
Pst I
1
5
5 15
6
2
12
1
5
1 19
6
2
12
2
6
12
1
5
3 17
2
6
12
1
5
7 13
2
6
12
4
8
35
Final Map
P
5
1
4
8
2
E
E
H
Hi Ec Hi/Ec 12 12 8 8 6 6 4 2 2
Ps Ps/Ec 13 12 7 5 2 1
36
Mapping deletions
Say you isolated this DNA from a region coding
for GeneA, from a normal Patient and one
suffering from a syndrome. The fragment was 17kb
in the affected individual rather than 20kb in
the normal patient
You draws restriction maps for the normal patient
6
8
2
E
H
E
4
You draws restriction maps for the affected
individual
6
8
2
E
H
E
1
There is a 3kb deletion in the 4kb HindIII/EcoRI
fragment
37
Complex Mapping
Often maps are more complex and difficult to
analyze using single and double digests alone. To
simplify the analyses, you can isolate each EcoRI
band from the gel and then digest with HindIII
12kbHindIII
2kbHindIII
6kbHindIII
EcoRI HindIII
Marker
Marker
HindIII
Marker
Marker
12kb
2kb
EcoRI
6kb
14
14
14
14
12
12
12
12
6
6
6
6
4
4
4
4
2
2
2
2
1
1
1
1
38
Mt DNA
Y chromosomes can be used to study paternal
lineage mtDNA can be used to follow maternal
lineage Cells contain organelles- Mitochondria
are organelles that produce Energy. They contain
a small 17,000 bp circular DNA. It encodes for 13
proteins in human cells and some tRNAs
Hypervariable region (150 bp)
tRNA
CytochromeB
NADH dehydrogenase
cytochromeC oxidase
ATP synthase
Mitochondrial DNA inheritance is not mendelian It
is inherited maternally
39
Argentina
1976-1983 Military rule in Argentina-10,000
deaths Grandmothers of the plaza de Mayo
contacted AAAS about missing grandchildren Mary
Claire King/ Allan Wilson- UC-Berkeley (Human
lymphocyte antigen-HLA) Mapping mitochondria
made it possible to match Child with maternal
grandmother!
Additional mutations generate diversity. You have
individuals With A, B, C and D DNAs
40
Eve
Geographic region
DNA
A
Mutation generates B from A. Now you have
individuals With A and B DNA in population.
C
A
B
A
B
D
41
Out of Africa
E
C
C
C
F
A
B
A
B
G
D
D
C migrates to form a separate population. Addition
al mutations diversify DNAs in populations. Origin
al population more diverse than newer population
Compared sequences of mtDNA There are greater
sequence differences among Africans than any
other group (Europeans, American Indians, Asians,
etc etc) The african population had the longest
time to evolve variation And thus humans
originated in Africa.
42
Using DNA to study History
This hypothesis was initially derived from
restriction maps of mitochondrial DNA
America
Australia
Europe
Asia
Africa
Eves DNA
All humans are derived from a small African
population about 170K yrs ago
43
Cloning DNA
A reasonable question is how did we get the 20kb
fragment in the first place? Or how do we
obtain the gene To understand the origin of the
fragment we must address the issue of The
construction of Recombinant DNA molecules or
cloning of DNA molecules Recombinant DNA is
generated through cutting and pasting of DNA to
produce novel sequence arrangements Restriction
enzymes such as EcoRI produce staggered cuts
leaving short single-stranded tails at the ends
of the fragment. These cohesive or sticky ends
allow joining of different DNA fragments
nnnGAATTCnnn nnnCTTAAGnnn
When a piece of DNA is cut with EcoRI, you get
nnnG AATTCnnn nnnCTTAA Gnnn
44
Cloning DNA
A reasonable question is how did we get the 20kb
fragment of DNA in the first place? To
understand the origin of the fragment we must
address the issue of The construction of
Recombinant DNA molecules or cloning of DNA
molecules Recombinant DNA is generated through
cutting and pasting of DNA to produce novel
sequence arrangements
45
Recombinant DNA
Restriction enzymes such as EcoRI produce
staggered cuts leaving short single-stranded
tails at the ends of the fragment. These
cohesive or sticky ends allow joining of
different DNA fragments
GAATTC CTTAAG
When a piece of DNA is cut with EcoRI, you get
AATTC-----------------G G-----------------CTTA
A
AATTC-----------------G G-----------------CTTA
A
5AAAAAAAAAAGGGGTTTTTTTG AATTCAAAAAAAAAAAAAAGG
GGGGGGTTTTTTTG AATTCAAAAAAAAGGGGGGGGTTTTTT3 3
TTTTTTTTTACCCCAAAAAAACTTAA
GTTTTTTTTTTTTTTCCCCCCCCAAAAAAACTTAA
GTTTTTTTTCCCCCCCCAAAAAA5
46
Plasmids
Plasmids are naturally occurring circular pieces
of DNA in E. coli
The plasmid DNA is circular and usually has one
EcoRI site. It is cut with EcoRI to give a
linear plasmid DNA molecule
47
Plasmids
Small circular autonomously replicating
extrachromosomal DNA
Modified plasmids, called cloning vectors Are
used by molecular biologists to isolate Large
quantities of a given DNA fragment Plasmids used
for cloning share three properties Unique
restriction site Antibiotic resistance Origin
of replication
Bacterial genome (5000kb)
Plasmid DNA (3kb)
Origin
Antibiotic resistance gene
48
Plasmid elements
Origin of replication This is a DNA element that
allows the plasmid to be replicated and
duplicated in bacteria. Each time the bacterium
divides, the plasmid also needs to divide and go
with the daughter cells. If a plasmid cannot
replicate in bacteria, then it will be lost.
49
Plasmid elements
Antibiotic resistance This allows for the
presence of the plasmid to be selectively
maintained in a given strain of bacteria
Lab bacterial strains are sensitive to
antibiotics. When grown on plates with
antibiotics, they die. The presence of a plasmid
with the antibiotics resistance gene allows these
lab strains to grow on plates with the
antibiotic. You are therefore selecting for
bacterial colonies with the Plasmid
50
Plasmid elements
Unique restriction sites For cloning the plasmid
needs too be linearized. Most cloning vectors
have unique restriction sites. If the plasmid
contains more than one site for a given
restriction enzyme, this results in
fragmentation of the plasmid
Why does this matter?
51
pUC18
pUC18 is a commonly used plasmid pUC plasmid
University of California
Plasmid replicon copy No pBR322 pMB1 15 pUC18
pMB1 500 pACYC p15A 10 pSC101 pSC101 5
52
Cloning DNA
GAATTC CTTAAG
When a piece of DNA is cut with EcoRI, you get
AATTC-----------------G G-----------------CTTA
A
AATTC-----------------G G-----------------CTTA
A
When tow pieces of DNA cut with EcoRI are ligated
back together you get back an EcoRI site
-----------------G -----------------CTTAA
AATTC----------------- G-----------------
53
(No Transcript)
54
Ligation
GENOMIC DNA
The EcoRI linearized PLASMID DNA is mixed with
HUMAN DNA digested with EcoRI The sticky ends
will hybridize/anneal specifically and a
recombinant plasmid will be generated
55
Cloning
The genomic DNA fragments is mixed with a plasmid
that has been linearized at a single EcoRI site
(say pUC18)
Both the plasmid and genomic DNA have been cut
with EcoRI, they have complementary sticky ends
G A A T T C C T T A A G
56
Recombinant plasmid
This process where foreign genomic DNA is joined
to plasmid DNA is called ligation It results in
recombinant plasmid (foreign DNAplasmid) Each
plasmid has one foreign EcoRI fragment Each
foreign fragment is still present as only one
copy! This is not useful.
57
Incompatibility of sticky ends
G A A T T C C T T A A G
Plasmid cut with EcoRI
Genomic DNA cut with HinDIII
A A G C T T T T C G A A
Wont work!!
AGCT-----------------------------
-----------------------------TCGA
58
Transformation
The entire collection of these plasmids bearing
genomic DNA inserts is called a Genomic
Library! These plasmids are added back into
bacteria by a process called transformation
The bacteria are selected for the presence of the
Plasmid by growth on media containing antibiotics
Each colony of E. coli will harbor one plasmid
with one piece of genomic DNA. Only cells with
plasmid will grow on plates with antibiotics (the
antibiotic resistance gene on plasmid allows
these cells to grow). Cells that did not take up
a plasmid will not grow.
59
Plasmid propagation
The plasmid DNA can replicate in bacteria and
therefore many copies of the plasmid will be
made. The human DNA fragment in the plasmid will
also multiply along with the plasmid DNA. THE
DNA IS CLONED Normally a gene is present as 2
copies in a cell. If the gene is 3000bp long
there are 6x103 bp in a total of 6x109 bp of the
human genome Once ligated into a plasmid,
unlimited copies of a single gene can be
produced.The process of amplifying and isolating
the human DNA fragment is called DNA cloning.
60
Why are plasmids important?
Most genes are present as two copies in the
entire genome. Plasmids allow us to obtain 1000s
of copies of a gene in a pure form
61
Cloning genes
Cloning and Expression of genes in cells Coding
region of protein Enhancer, Promoter, Ribosome
binding site
B
E
No cloning of RNA into double stranded plasmid
DNA No cloning of single stranded DNA into
double stranded plasmid DNA
62
Coding region cloning
H
63
Promoter cloning
64
Isolate the plasmid
To isolate the gene fragment, we grow up a large
population of E. coli containing the plasmid with
the gene insert. A simple procedure allows us to
isolate the plasmid (which is smaller than
Chromosomal DNA) Once we have purified the
plasmid we have 1000s of copies of Gene in a
plasmid We can take the plasmid and cut it with
EcoRI. When the digest is run on an agarose gel,
we get two bands- one corresponding to the
plasmid and one to the insert. The DNA present
in the band corresponding to the insert can be
isolated from the gel PURE GENE !!!!!
65
Foreign gene expression
What if you want to express Influenza antigen in
chicken cells?
Influenza virus regulatory sequences do not work
in chicken cells Connect Influenza antigen gene
to a chicken enhancer/promoter Splicing
regulatory sites, translation regulatory sites
will also have to be Chicken specific
66
Mixing and matching
67
Inter-species Gene transfer
CF gene on a plasmid
CF
Isolate Plasmid
Transfect human cell with CF plasmid
Human Cell is cf-/cf- It becomes CF after
transfection
68
Definition of Key Terms
Cisgenics Genetic modification of a recipient
plant/animal with a gene from a sexually
compatible plant/animal species Transgenics Genet
ic modification of a recipient plant with a gene
from a sexually incompatible plant/animal or
other organism Traditional breeding Conventional
cross breeding of two species of plants to
transfer a gene from one species to the
other Are cisgenics acceptable? Are transgenics
acceptable?
69
(No Transcript)
70
Genetically modified organisms GMO
Attempts to cross wheat and rye produce sterile
offspring. New techniques were developed that
allowed production of fertile hybrid. The two
plants were treated with a potent toxin
colchicine and the genomes were severely
MUTAGENIZED The mutagenesis allowed the genome
of wheat and rye (these are different species) to
overcome the species barriers, fuse and form a
NEW SPECIES !! These plants were used to develop
genetically novel plants with traits from wheat
and rye parents producing a SuperFood GOOD
IDEA? BAD IDEA?
71
Genetically modified plants
Ethylene gas released by fruit accelerates the
ripening process. Prevention of ethylene
production would block the fruit from ripening
prematurely and spoiling on the way to the
market. The ethylene biosynthetic pathway is as
follows Precursor-----gtACC------gtethylene ACC
ACC synthase oxidase
Genetic technology was used to generate mutants
in the plant so that they could not synthesize
the enzymes required for ethylene gas
production. Generated and marketed the SUPER
SAVR TOMATO GOOD IDEA? BAD IDEA?
72
Genetically modified plants
A species of bacteria produces a potent natural
pesticide This toxin is used in organic
farming The gene necessary for producing the
toxin was identified and cloned. It was then
modified and inserted into the genome of cotton
plants. This bacterial gene was now able to
replicate in cotton and the plant made and
secreted the toxin. The plant now produced the
toxin thus eliminating the need for pesticide
spraying. This would reduce the harmful effects
of pesticides on humans GOOD IDEA? BAD IDEA?
73
CORN
Ancient corn roots emit a volatile substance,
b-caryophyllene, when attacked by insects. The
substance attracts nematodes to the roots. These
worms eat the insects protecting the
corn. Commercial corn has a mutation and cannot
produce b-caryophyllene. The wild type gene
b-caryophyllene synthase was cloned. A
commercial corn plant was transformed with the
wild type gene -b-caryophyllene synthase. The
plant could now produce b-caryophyllene and was
resistant to insects. Good Idea Bad Idea?
Ancient corn x commercial corn Small
cob large cob Large height short height Insect
resistant insect sensitive Slow growth rapid
growth Easily stressed stress resistant
74
Genetically modified plants Trititcale- created
in the 1880s-1930s by the Edinburgh Botanical
Society. Using chemical mutagenesis combined with
Mendelian crosses. It is currently sold primarily
in organic health food stores. Is it a good idea
to mutate crops using chemical mutagens? Flavor
Savr tomato helps transport fragile food
preventing waste. Labeled a Frankenfood. It has
a single mutation in one gene. Is it a good idea
to mutate crops using recombinant DNA methods?
What if you made the same mutation by classical
genetics? Bt cotton created in the 1990s using
recombinant DNA and transgenic technology. What
if you inserted a gene from one species in to
another species using classical
genetics? Reinserting Caryophyllene synthase
into corn restores its natural insect resistance
which was lost when commercial corn varieties
were generated by classic breeding techniques.
What if you inserted this gene back by genetic
crosses? Gene blocking may produce tea, coffee
without the caffeine Tomatoes with a higher
antioxidant (lycopene) content Fungal resistant
bananas Smaller, seedless melons for use as
single servings Bananas and pineapples with
delayed ripening qualities Message Understand
the differences (GM-foods) pre- and post-1990
75
(No Transcript)
76
Genomic clones
What are genomic clones What are cDNA
clone What is a PCR clone of a specific gene
77
(No Transcript)
78
Each fragment is ligated into the plasmid Each
plasmid is put (transformed) into E.coli Each E.
coli colony on a plate has one specific plasmid
C
D
A
B
79
Genomic clone libraries
Species Genome size average plasmids
insert size E. Coli 5000kb 16
kb 1300 Drosophila 150,000kb 16
kb 46,000 Human 3000,000kb 16 kb gt100,000
An entire genome of any organism can be cloned as
small fragments in plasmids The larger the
genome, the more difficult the task At present,
genomic DNA libraries exist for a large number of
organisms including Yeast, C.elegans,
Drosophila, Zebrafish, Xenopus, Chickens, Mouse,
Humans etc
80
cDNA clone
RNA Cannot be cloned Reverse transcriptase
copies RNA into DNA So to clone RNA, you first
convert RNA into DNA using reverse
transcriptase This DNA (cDNA) is an
complementary copy of the RNA (RNA was the
template) The cDNA is then cloned into plasmids
81
cDNA
Often we have RNA rather than DNA as the starting
material For instance in the case of the human
hemoglobin gene, we started with globin mRNA RNA
is difficult to work with. In contrast to DNA,
RNA breaks down and degrades very easily. There
are no restriction enzymes that cut RNA at
specific sites. RNA cannot be cloned. It cannot
be inserted into a plasmid and amplified since
all Plasmids are DNA. The enzyme reverse
transcriptase has proven very useful to molecular
biologists. This enzyme catalyzes the synthesis
of DNA from a RNA template. It is normally found
in a large class of viruses. The genome of these
viruses is RNA!! These viruses are called
retroviruses.They infect eukaryotic cells and use
these cells to grow/replicate Retroviruses carry
an RNA genome. Interestingly they will integrate
into the DNA of the host. For RNA to integrate
into DNA, first the RNA has to be converted to
DNA Remember the central dogma of molecular
biology Information flows from DNA to RNA to
protein! DNA----gtRNA----gtprotein Reverse
Transcriptase reverses this dogma (partially)
82
cDNA synthesis
83
cDNA/splicing
So from globin mRNA, a complementary DNA molecule
can be created using reverse Transcriptase. This
complementary DNA is called cDNA. The cDNA can
now be inserted into a plasmid and cloned. What
is the relationship between a cDNA clone and a
genomic clone? Splicing In eukaryotes, the
coding sequences are interrupted by introns
84
Genomic Vs cDNA
Genomic clones represent the organization of the
DNA in the nucleus! cDNA clones represents the
organization of mRNA sequences after the gene has
been transcribed, processed and exported to the
cytoplasm. cDNA clones contain the sequence of
nucleotides that code for the mRNA--protein! cDNA
clones do not contain the sequence of the
promoter of the gene or the intron. The starting
material for cDNA clones is different from
material used to make genomic clones
Genomic clone cDNA clone Source Nucleii cyt
oplasmic RNA (any cell) (specific cell
type) Use Studies on gene Studies
directed organization towards coding
regions structure
85
(No Transcript)
86
Sequencing
Reference Genome- Number of donor DNAs are
sequenced Consensus sequence is reference
genome Pieces of DNA are sequenced many
times Computers are used to overlap the pieces
to generate contigs Sequences of individuals
will vary from the reference genome UCSC
Genome Browser
87
PCR
Its a method that can be used to make many
copies of a particular DNA sequence from a
particular individual You have to know the DNA
sequence before you can amplify that sequence (it
does not have to be cloned) The sequence will
not propagate (replicate) in living organisms
88
PCR clone
PCR cloning IF YOU KNOW THE SEQUENCE OF THE GENE
YOU WANT TO CLONE You can use PCR to first make
many copies of your gene Then you can clone
those copies into a plasmid.
89
(No Transcript)
90
Blotting
You can Restriction map a cloned piece of
DNA Can you restriction map a piece of DNA in
the genome without first cloning it?
91
Southern blotting
Rapid method of identifying a specific DNA
fragment from a mixture of fragments
How do you determine which band corresponds to
insert and which to the plasmid
92
A probe is used to identify genomic DNA?
DNA is transferred from the gel to a paper filter
The DNA (plasmid and chromosomal) on the paper is
denatured (converted from ds to ss) Then you
take the filter and to it add radiolabeled probe
(small part of Gene).
93
Southern blotting with a probe
The probe AAAAAAA will bind the single stranded
DNA that has a complementary sequence (TTTTTT).
It will specifically hybridize with the insert
(genomic DNA) A probe with this specific
sequence is generated and made radioactive Incuba
te the filter with the radio-labeled probe A
specific probe enabled us to identify a DNA
fragment that corresponds to a specific gene of
interest.
94
PROBES
Probes are obtained in a number of ways RNA as a
source The probe for hemoglobin can be obtained
from mRNA of immature red blood cells. The major
transcript of these cells is from the hemoglobin
gene. So isolating RNA from these cells, we can
obtain a relatively pure probe for the hemoglobin
gene Protein If you have a purified protein,
the amino acid sequence can be determined. From
the amino acid sequence, using the genetic code a
corresponding DNA sequence can be synthesized and
this small DNA piece can be used as a
probe Homology Probes from conserved genes-Many
genes are conserved from one species to
another Chimpanzee and human DNA are 97
identical. If you know the sequence of a gene in
chimps, then you will be able to know the
sequence for the gene in humans! The histone
genes are highly conserved across phyla. Histone
proteins have three Amino acid differences
between humans and peas Histone genes have been
isolated in yeast, they can serve as probes for
screening a Human genomic library- cloning by
phone The computer databases PCR
95
What about a genome?
What if Gene C was in a large genome. Could we
identify the fragment by Southern blotting
Transfer to membrane
Hybridize with Probe C
Based on the blot what is the restriction map for
gene C?
96
Map by Blotting
Actual Map
Southern Blot inferred Map
97
GeneC
Mapping chromosomal DNA with different
probes Probe A 2Kb fragment
Probe B 2Kb and 4Kb fragment
ProbeC 4Kb fragment
98
You can build a genomic restriction map
If we digest the DNA with HindIII instead of
EcoRI what will happen?
4
1
2
3.5
1.5
0.5
99
Mapping deletion with probe A.
1
2
4
A
B
1
1
4
A
B
Mapping deletion with probe B.
100
Rapid analysis of globin gene (large deletion)
M
M
H
M
H
0.2kb
1.1kb
Exon1
Exon2
D
0.3kb deletion
MstII
HindIII
Marker
WT
Marker
Del
WT
Del
1.1
1.35
1
1.05
0.2
101
Map by Blotting
Actual Map
Southern Blot inferred Map
102
Very small Deletion of restriction site
103
(No Transcript)
104
Northern blot
This is a rapid method that allows you to
determine the cell type in which a specific gene
is active and being transcribed.
Brain
Bone
Blood
Embryo
Lung
liver
These tissues differ because each is transcribing
a unique subset of genes. Each tissue contains a
unique and distinct mRNA population
Presence of RNA is a reflection of gene activity
105
Northern blot
Method is analogous to Southern blots Instead of
DNA as the starting material, you use RNA. You
take cells, break them open, isolate the RNA and
run the RNA on a gel Transfer RNA to membrane
and use probe for gene of interest. The RNA can
be from specific tissues or cell types
Presence of RNA is a reflection of gene activity
106
Microarray
Microarrays are miniature devices containing
thousands of DNA sequences stuck on at different
positions (addresses). Hybridisation to complex
mixtures of labelled DNA molecules, prepared from
cellular RNA, shows the relative expression
levels of thousands of genes. This can be used to
compare gene expression levels within a sample or
look at differences in the expression of specific
genes across different samples. Key principles
RNA isolated from a particular cell type or
tissue comprises a complex mixture of different
RNA transcripts. The abundances of individual
transcripts in the mixture reflect the expression
levels of the corresponding genes. A
microarray is a small device, about the size of a
microscope slide, with thousands of different
known DNA sequences immobilised at different
addresses on the surface. Each of these
DNA sequences can participate in a hybridisation
reaction. If a complex DNA mixture copied
from the above RNA is labelled and hybridised to
the microarray, the strength of the signal at
each address shows the relative expression levels
of the corresponding gene. Microarrays can be
used to compare gene expression levels within a
sample or look at differences in the expression
of specific genes across different samples. How
does it work? Single DNA strands with
complementary sequences can pair with each other
and form double-stranded molecules. This
hybridisation process occurs with such
specificity that a labelled DNA probe - a single
DNA strand carrying a label that allows it to be
detected can pick out a matching partner, the
target, in a complex mixture containing millions
of different sequences. Microarrays apply the
hybridisation principle in a highly parallel
format. Instead of one target, thousands of
different potential targets are arrayed on a
miniature solid support. Instead of a unique
labelled DNA probe, a complex mixture of labelled
DNA molecules is used, prepared from the RNA of a
particular cell type or tissue. The abundances
of individual labelled DNA molecules in this
complex probe reflect the expression levels of
the corresponding genes. When hybridised to the
array, abundant sequences will generate strong
signals and rare sequences will generate weak
signals. The strength of the signal thus
represents the level of gene expression in the
original sample. How is it used? Expression
analysis with microarrays can be used to
determine what genes are expressed in a
particular cell type or tissue and to compare the
expression levels of different genes. It can
also be used to compare gene expression across
different but related samples, such as disease vs
healthy tissue. A gene expressed only in the
disease sample, for example, might represent a
useful drug target. Comparative expression
analysis can be achieved by comparing duplicate
microarrays hybridised to complex probes prepared
from the alternative samples. A refinement of
the technique, in which RNA from the related
samples is labelled with different fluorescent
molecules, allows this analysis to be carried out
on a single microarray.
107
Microarrays
These are reverse northern blots. Allows us to
examine gene expression of all of the genes in
the genome! Each spot is DNA for one defined
gene. Each gene DNA is spotted in a grid. They
cover the entire genome.
Make total RNA from normal and mutant cell, Label
each total RNA differently Wtred Mutgreen Add
labeled RNA from normal and mutant cells to array
and let hybridize Measure label and determine
change
Ratio of WT/mut
1, 2, 3 are sequences specific for gene1,
gene2, gene3 etc printed on the slide
108
Use of microarrays
To measure changes in transcription of genes
during drug treatment To identify deletions in DNA
A microarray works by exploiting the ability of a
given mRNA molecule to bind specifically to, or
hybridize to, the DNA template from which it
originated.
109
Genome sequencing
Whether bacterium or human, the genome of any
organism to too large to be deciphered in one go.
The genome is therefore broken into smaller
pieces of DNA, each piece is sequenced and
computers fit all the sequences back
together. The human chromosome to be
sequenced. The chromosome is first chopped
randomly into conveniently sized chunks. These
large fragments are inserted into bacterial
artificial chromosomes (BACs) and cloned in
bacteria. These fragments are then mapped so it
is known which region of the chromosome they came
from. Each BAC is shotgunned - broken randomly
into many small pieces. This process is repeated
several times to give different sets of
fragments. (The whole-genome shotgun method goes
directly to this stage.) The fragments are cloned
in small vectors and then sequenced. About 500
bases of sequence information is produced from
each fragment. The sequences are fed into a
computer, which looks for overlaps at the end of
the sequence to find neighbouring fragments. When
many fragments have been sequenced the sequence
of the original BAC insert can be assembled. The
process is carried out for all the BACs to give a
complete chromosomal sequence. For example, the
human genome is about 3 billion base pairs,
arrayed in 24 chromosomes. The chromosomes
themselves are 50250 million bases (megabases)
long. These tracts of DNA are much too large for
even the latest automated machines, which
sequence fragments of DNA between 400 and 700
bases long. The genome is first broken into
conveniently sized chunks, fragments of about 150
kilobases. Each fragment is inserted into a
bacterial artificial chromosome (BAC), a cloning
vector used to propagate DNA in bacteria grown in
culture. The BACs are then mapped, so that it is
known exactly where the inserts have come from.
This process makes re-assembling the sequenced
fragments to reflect their original position in
the genome easier and more accurate, and any one
piece of human DNA sequence can automatically be
placed to an accuracy of 1 part in 30 000. Each
of the large clones is then 'shotgunned' - broken
into pieces of perhaps 1500 base pairs, either by
enzymes or by physical shearing - and the
fragments are sequenced separately. Shotgunning
the original large clone randomly several times
ensures that some of the fragments will overlap
computers then analyse the sequences of these
small fragments, looking for end sequences that
overlap - indicating neighbouring fragments - and
assembling the original sequence of the clone. An
alternative approach, 'whole genome shotgun
sequencing', was first used in 1982 by the
inventor of shotgun sequencing, Fred Sanger,
while working on phages (viruses of bacteria). As
its name suggests, in this technique the whole
genome is broken into small fragments that can be
sequenced and reassembled. This method is very
useful for organisms with smaller genomes, or
when a related genome is already known.
110
Animal cloning
Animal clones are genetically identical. Natural
clones occur in the form of identical twins but
it is also possible to produce artificial clones
by nuclear transfer. The nucleus is removed from
a somatic (body) cell and placed in an egg whose
own nucleus has been removed. The egg is then
implanted in a surrogate mother and develops to
term. Key principles Differentiated animal
cells are unable to develop into complete animals
The nuclei of most differentiated cells
retain all the necessary genetic information.
Transfer such a nucleus into an egg whose own
nucleus has been removed. Transfer to the
environment of the egg reprograms the nucleus
(makes it forget its history) and allows the full
development of a viable animal that is
genetically identical to the donor of the somatic
cell. Until 1997, cloning in mammals was
only possible using nuclei obtained from very
early embryos. A breakthrough was made when
cloning was achieved using nuclei from adult
cells. Recent research suggests that
animals produced by cloning from adult cells may
age prematurely, but further investigation is
necessary. How does it work? Nuclear transfer is
carried out by fusing the donor somatic cell to
an egg whose own nucleus has been removed. Fusion
is achieved in a culture dish by applying an
electric current. The change in electrical
potential also mimics the normal events of
fertilisation and initiates development. A key
aspect in the success of nuclear transfer is
synchronisation of the cell cycles between the
donor nucleus and the egg. Before fertilisation,
the egg's nucleus is quite inactive. The nucleus
of the donor cell must also be made inactive
otherwise it will not be reprogrammed and
development will fail. Inactivation is achieved
by culturing the cell but starving it of
essential nutrients. The cell stops dividing and
enters a quiescent state compatible with nuclear
transfer. How is it used? Animal cloning has the
potential to overcome the limitations of the
normal breeding cycle. In the future, it may be
used to produce elite herds by cloning the
superior animals, or to rapidly produce herds of
transgenic or otherwise modified animals.
Transgenic farm animals make useful bioreactors,
producing valuable proteins in their
milk. Another application is the use of
genetically-modified pigs as a source of organs
suitable for transfer to humans
(xenotransplantation).
111
xxxxxx
112
How is a specific gene isolated (CLONED)?
Its like going to the library and looking for a
specific book. It involves screening through a
genomic library. A genomic library is a large
collection of plasmids containing pieces of DNA
from a specific species. The set of cloned
fragments is so comprehensive that virtually the
entire genome is represented in the library. The
fragments that make up the library are initially
generated by digesting genomic DNA (e.g. human)
with a restriction enzyme- say EcoRI The EcoRI
sites are randomly distributed in the genome-
fragments of varying lengths will be
generated. Some fragments will contain one gene,
others two genes or cut genes in half.
113
Each fragment is cloned into the plasmid, each
plasmid is put (transformed) into E.coli
C
D
A
B
114
The library is random!
Each fragment is cloned into the plasmid, each
plasmid is put (transformed) into E.coli
C
D
A
B
115
Fragments,bookmark, title
The library is not bookmarked or even titled and
is in fragments! There is no organization to
the library. It is simply a populations of
cloned fragments representing the entire
genome. The equivalent of this would be if you
went to the University Library to find all the
books in a large heap, the books had no title,
and in addition instead of entire books you often
found parts of books. How do you use such a
library? How do you find the book you are
interested in.
Lets work our way through this problem with a
simple example Organism has EIGHT genes in its
genome
A
B
C
D
E
F
G
H
EcoRI
116
Genomic library
If we wanted to study gene C- Create a
restriction map of gene C Determine it
sequence Study proteinC What do we need to do
We need to initially clone the gene and make many
copies of gene C Creating a genomic library
provides a means of obtaining many copies of gene
C To generate a genomic library Total genomic
DNA is isolated from the species of interest The
DNA is cut with EcoRI
A
B
C
D
E
F
G
H
117
Genomic library
These genomic DNA fragments are mixed with a
plasmid that has been linearized at a single
EcoRI site (say pUC18)
Both the plasmid and genomic DNA have been cut
with EcoRI, they have complementary sticky ends
G A A T T C C T T A A G
118
Recombinant plasmid
This process where foreign DNA is joined to
plasmid DNA is called ligation It results in
recombinant plasmid (foreign DNAplasmid) Each
plasmid has one foreign EcoRI fragment Each
foreign fragment is still present as only one
copy! This is not useful.
119
How are genomic libraries used?
If we are interested in studying gene C, you need
the plasmid containing gene C Having a genomic
library means you have gene C, but where is it?
Which colony on the Petri dish contains gene
C? Genomic libraries are much more complex than
the one described for our hypothetical 8 gene
organism You need to identify one recombinant
plasmid out of 100,000s present in a
library. Identifying and isolating a specific
plasmid is called screening a library. This
requires a probe A probe is a sequence
complementary to PART of the sequence one wishes
to pull out. You radiolabel the probe and once
labeled the probe is used to identify the plasmid
containing E. coli colony How do we get the
probe?
120
The genomic library and a specific probe enabled
us to achieve two goals Out of the billions of
base pairs in a large genome, we have been able
to identify a few 1000 base pairs that correspond
to a specific gene of interest. In addition we
were able to isolate this sequence on a
specifically engineered plasmid That allows us to
make large quantities of this rare
sequence. Genomic libraries are described in
terms of average fragment size and the number of
plasmids that must be screened to have the entire
genome represented To have a good probability
(gt99) of identifying a given DNA sequence (gene)
present in the collection of plasmids (library).
The number of plasmids (colonies) that must be
screened is a function of the size of the genome
of the species from which the Library was
constructed.
121
xxxxxx
About PowerShow.com