Exodus 15:26 - PowerPoint PPT Presentation

Loading...

PPT – Exodus 15:26 PowerPoint presentation | free to download - id: 7133e3-MTM5Z



Loading


The Adobe Flash plugin is needed to view this content

Get the plugin now

View by Category
About This Presentation
Title:

Exodus 15:26

Description:

26 If thou wilt diligently hearken to the voce of the LORD thy God, and wilt do that which is right in his sight, and wilt give ear to his commandments, and keep ... – PowerPoint PPT presentation

Number of Views:95
Avg rating:3.0/5.0
Slides: 27
Provided by: TG75
Category:

less

Write a Comment
User Comments (0)
Transcript and Presenter's Notes

Title: Exodus 15:26


1
  • Exodus 1526
  • 26 If thou wilt diligently hearken to the voce
    of the LORD thy God, and wilt do that which is
    right in his sight, and wilt give ear to his
    commandments, and keep all his statutes, I will
    put none of these diseases upon thee, which I
    have brought upon the Egyptians for I am the
    LORD that healeth thee.

2
Phage Strategies
  • Timothy G. Standish, Ph. D.

3
(No Transcript)
4
Phage Reproduction The Lytic Cycle
5
Phage Reproduction The Lysogenic Cycle
Integration of phage DNA into the bacterial genome
6
The l Genome
7
Order of Gene Expression
8
The l Regulatory Region
N utilization right
Terminator right
N utilization left
Terminator left
Repressor
Positive regulator
Anti-repressor
Anti-terminator
Positive regulator
c clear referring to the clear plaques
resulting from functional c genes
9
The l Regulatory Region
Promoter Represser Establish-ment
Promoter/ Operator right
Promoter/ Operator left
Promoter Represser Maintainence
Repressor
Positive regulator
Anti-repressor
Anti-terminator
Positive regulator
c clear referring to the clear plaques
resulting from functional c genes
10
The l Regulatory Region Infection
Host RNA Polymerase recognizes PL and PR and
begins transcription of the N and cro proteins
11
The l Regulatory Region Infection -
Establishment of Lysogeny
Host RNA Polymerase recognizes PL and PR and
begins transcription of the N and cro proteins
As they are the very first genes to be expressed,
N and cro are called immediate early genes.
cro
12
The l Regulatory Region Infection -
Establishment of Lysogeny
pN binds to nut sites allowing transcription
through tR1 and tL
cro
13
The l Regulatory Region Infection -
Establishment of Lysogeny
pN binds to nut sites allowing transcription
through tR1 and tL
cro
14
The l Regulatory Region Infection -
Establishment of Lysogeny
The cII and cIII proteins are produced. In vivo a
protein called HflA rapidly breaks down cII
unless it is combined with cIII. cII up
regulates transcription from PRE.
cro
15
The l Regulatory Region Infection -
Establishment of Lysogeny
Transcription from PRE makes mRNA complimentary
to the cro mRNA thus inhibiting cro translation
cro
16
The l Regulatory Region Infection -
Establishment of Lysogeny
The transcript from PRE provides a 3
untranslated region with an efficient ribosome
binding site before the start of the cI gene,
thus cI repressor is efficiently produced.
17
The l Regulatory Region Infection -
Establishment of Lysogeny
The repressor gene product of cI binds to OR and
OL preventing transcription from PR and PL.
18
The l Regulatory Region Infection -
Establishment of Lysogeny
The repressor up-regulates expression from PRM
maintaining repressor production and preventing
expression of any other proteins and establishing
lysogeny.
cI
cI
19
The l Repressor Protein
  • Repressor protein has two functional domains
  • An amino acid (residue) 1-92 N-terminal DNA
    binding domain which binds to OR and OL
  • A C-terminal protein binding domain essential for
    dimerization running from amino acids 132-236
  • A 40 residue connector runs Between the two
    domains

Repressor only binds DNA efficiently when it is a
dimer
20
The l Regulatory Region Infection -
Establishment of The Lytic Cycle
Host RNA Polymerase recognizes PL and PR and
begins transcription of the N and cro proteins
As they are the very first genes to be expressed,
N and cro are called immediate early genes.
cro
21
The l Regulatory Region Infection -
Establishment of The Lytic Cycle
Host RNA Polymerase recognizes PL and PR and
begins transcription of the N and cro proteins
cI
cro
22
The l Regulatory Region Infection -
Establishment of The Lytic Cycle
Host RNA Polymerase recognizes PL and PR and
begins transcription of the N and cro proteins
5CATACGTTAAATCTATCACCGCAAGGGATAAATATCTAACACCGTGC
GTGTTGACTATTTTACCTCTGGCGGTGATAATGGTTGCATG3 3ATG
TGCAATTTAGATAGTGGCGTTCCCTATTTATAGATTGTGGCACGCACAA
CTGATAAAATGGAGACCGCCACTATTACCAACGTAC5
cI
cro
23
The l Regulatory Region Infection -
Establishment of The Lytic Cycle
5CATACGTTAAATCTATCACCGCAAGGGATAAATATCTAACACCGTGC
GTGTTGACTATTTTACCTCTGGCGGTGATAATGGTTGCATG3 3ATG
TGCAATTTAGATAGTGGCGTTCCCTATTTATAGATTGTGGCACGCACAA
CTGATAAAATGGAGACCGCCACTATTACCAACGTAC5
cI
cro
The N terminus of the repressor binds to OR1 and
2 with high affinity
The N terminus of the repressor binds to OR1 and
2 with high affinity
The N terminus of the repressor binds to OR1 and
2 with high affinity
24
The l Regulatory Region Infection -
Establishment of The Lytic Cycle
Host RNA Polymerase recognizes PL and PR and
begins transcription of the N and cro proteins
5CATACGTTAAATCTATCACCGCAAGGGATAAATATCTAACACCGTGC
GTGTTGACTATTTTACCTCTGGCGGTGATAATGGTTGCATG3 3ATG
TGCAATTTAGATAGTGGCGTTCCCTATTTATAGATTGTGGCACGCACAA
CTGATAAAATGGAGACCGCCACTATTACCAACGTAC5
cI
cro
25
The l Regulatory Region Infection -
Establishment of The Lytic Cycle
OR3 CTATCACCGCAAGGGATAA OR2 CTAACACCGTGCGTGTTGA OR
1 TTACCTCTGGCGGTGATAA OL3 TAACCATCTGCGGTGATAA OL2
TTATCTCTGGCGGTGTTGA OL1 ATACCACTGGCGGTGATAC
OR3 CTATCACCGCAAGGGATAA OR2 CTAACACCGTGCGTGTTGA OR
1 TTACCTCTGGCGGTGATAA OL3 TAACCATCTGCGGTGATAA OL2
TTATCTCTGGCGGTGTTGA OL1 ATACCACTGGCGGTGATAC CON -
TAYCWCYGGCGGTGWTR-
Right and left operator sites share a common
consensus sequence.
26
(No Transcript)
About PowerShow.com