Some Molecular Biology Techniques - PowerPoint PPT Presentation

1 / 21
About This Presentation
Title:

Some Molecular Biology Techniques

Description:

Some Molecular Biology Techniques * – PowerPoint PPT presentation

Number of Views:141
Avg rating:3.0/5.0
Slides: 22
Provided by: Carol416
Category:

less

Transcript and Presenter's Notes

Title: Some Molecular Biology Techniques


1
Some Molecular Biology Techniques
2
Some molecular things
  • Restriction Enzyme digestion
  • Ligation of DNA
  • Cloning DNA
  • PCR
  • cDNA synthesis
  • Gel electrophoresis
  • Southern /Northern /Western Blot
  • Sequencing

3
Restriction Enzyme digestion
  • Restriction endonucleases (3,000 studied)
  • 600 commercially available
  • Cut double stranded DNA at recognized base pairs
  • First found from microbes
  • Usually named after the organism eg. E.coli I
    (Escherichia coli), Sal I (Streptomyces albus),
    Sma I (Serratia marcescens)
  • EcoRI 5'GAATTC Sma I 5'CCCGGG
  • 3'CTTAAG
    3'GGGCCC
  • 5'---G A ATTC---3' 5'---CCC GGG---3
  • 3'---CTTA A G---5'
    3'---GGG CCC---5'

Blunt end restriction enzyme
sticky end restriction enzyme
4
Ligation of DNA
  • Ligase an enzyme that join double strand DNA
    pieces together
  • Catalyze the sugar phosphate backbone of the DNA
    together
  • T4 DNA ligase
  • ATP dependent
  • 37C

http//en.wikipedia.org/wiki/ImageDNA_Repair.jpg
5
Cloning DNA
  • More than one
  • library
  • Any DNA can be cloned
  • EST Express Sequence Tags
  • cDNA Copy DNA from transcriptome

6
PCR-based markers
Polymerase Chain Reaction amplification of
tracts of DNA defined by border sequences that
hybridize to selected DNA polymerase primers
Requires - target DNA - thermostable DNA
polymerase (Taq) - oligonucleotide primer(s)
(7-30nt) - dNTPs Mg
7
PCR Considerations
  • Does not require high quality DNA
  • Extremely sensitive - easily
  • contaminated
  • Reaction conditions must be
  • optimized and controlled
  • Fast
  • Relatively inexpensive

8
Primer design
  • Primer length to be considered (18-24 bases)
  • Exceptions (RAPD 10-12, Oligomicroarray 80)
  • Melting temperature (50C to 60C) Tm(oK)?H/ ?S
    R ln(C)
  • Primer annealing temperature Ta 0.3 x
    Tm(primer) 0.7 Tm (product) 14.9
  • GC content (40 to 60)
  • Secondary structure (avoid repeat within primer
    lt4 repeat eg. ATAT)
  • Runs (avoid stretches of CCC or GGG etc.)
  • End in G if possible for more stability

9
Polymerase Chain Reaction Diagram of the first 2
cycles
http//array.mc.vanderbilt.edu/ph_tour/pcr.fgsr
10
Gel Electrophoresis
  • Use for multiple purposes
  • Check restriction digestion
  • Check ligation efficiency
  • PCR products
  • Clone sizing

11
Reverse transcriptase an RNA-dependent DNA
polymerase
12
Blotting
  • Southern /Northern /Western Blot

http//www.molecularstation.com/images/western-blo
t.jpg
13
Dideoxy DNA Sequencing
  • Method invented by Frederic Sanger in 1977
  • Method still used today
  • Can be automated to sequence large stretches of
    DNA rapidly
  • Can be used to sequence Genomes

S. Chowrira
14
The sequencing method developed by Fred Sanger
forms the basis of automated "cycle" sequencing
reactions today.
Fluorescent dyes are added to the reactions
A laser within an automated DNA sequencing
machine analyzes the DNA fragments produced.
This method uses chemically altered "dideoxy"
bases to terminate newly synthesized DNA
fragments at specific bases (either A, C, T, or
G).
These fragments are then size-separated, and the
DNA sequence is deduced.
15
Sanger autosequencers
16
(No Transcript)
17
Start of automation?
18
Bioinformatics
  • Software to read the signals based on peak
    intensities from the florescense signals eg. Hex,
    Tamara, Cy3, Cy5, Infrad 700, Infrad 800
  • Beware of background and noise
  • Beware of double or more peaks
  • Peak quality assessment

19
At last some sequence data
  • ATGCATGAGNTA

20
More sequences
  • ATGCATGAGNTAAGTGAGTATACCGATANAGAACTGCGCAGTCGACGGGC
    CTTTACGACGACGCGCTACGCACGTATGCAATTGGCCATGACAGTCGACG
    ACACGTAGACGCCCAGGCAGCTGACGACTGCGTG

21
Endless sequences.Oh Boy! Now What!
  • 1 agtaggatgc ggccagcgca ggagctggtg gtgaaaaact
    gatctcgcat gttcagaaac
  • 61 tgcacaagct ctaccacatc ctcgtcaaca ctgcccttcc
    ggctgaggtc cgctttgctc
  • 121 aaacattgcg ccttccattt cctgaactcc gcgctgcgat
    ccatgggtga cggactcagg
  • 181 gtctgcgctc ggctccttca tggtagcctc gtctctccct
    gggggcagcc atattgaagc
  • 241 gagcggtggc cgaaaaggtc caaacttcct cttcgttctt
    aatttgggaa attctagtgc
  • 301 cttcgcctag gggtggagag aggcgcacat cctgggtgga
    gcgaggcgca catcctgggt
  • 361 ggagcctgca aaagttggag aaggtgtggc agtcctcatt
    tctgtggaat ctgaagaagc
  • 421 ccacgcagat tttaattccc actctagatt ctggttctaa
    tcaaggtcca tgcatgtggt
  • 481 gtcaaccccg tggagacata cattcgctct ggtacttata
    gtagaaaacc actcttaccc
  • 541 tatactcctg gctcagatgt ggctggggtg atagaagctg
    ttggagataa tgcatctgct
  • 601 ttcaagtgcc tgtgtgaaag ctggagagag tgttctggtt
    catggggcaa gtggaggagt
  • 661 tggattagca gcatgccaaa ttgctagagc ttatggctta
    aagattttgg gcactgctgg
  • 721 tactgaggaa ggacaaaaga ttgttttgca aaatggagcc
    catgaagtgt tcaatcacag
  • 781 agaagtgaat tacattgata aaattaagaa gtatgttggt
    gagaaaggaa ttgatataat
  • 841 tattgaaatg ttagctaatg taaatcttag taaagacttg
    agtcttctgt cacatggagg
  • 901 acgagtgata gttgttggca gcagaggtac tattgaaata
    aacccacgag acaccatggc
  • 961 aaaggagtcg agtataattg gagttactct cttttcctca
    accaaggagg aatttcagca
  • 1021 atatgcagca gcccttcaag ctggaatgga aattggctgg
    ttgaaacctg tgataggttc
  • 1081 tcaatatcca ttggagaagg tggccgaggc tcatgaaaat
    atcattcatg gtagtggggc
Write a Comment
User Comments (0)
About PowerShow.com