Genomes and Genomics - PowerPoint PPT Presentation

1 / 29
About This Presentation
Title:

Genomes and Genomics

Description:

... between different animals/plants/bacteria Structural Genomics Studying structure of proteins produced by genes Pharmacogenomics How ... haplotype Similar ... – PowerPoint PPT presentation

Number of Views:221
Avg rating:3.0/5.0
Slides: 30
Provided by: bioPrions
Category:

less

Transcript and Presenter's Notes

Title: Genomes and Genomics


1
Genomes and Genomics
2
Learning Objectives
  • By the end of this class you should understand
  • The information that may result from sequencing a
    genome
  • The techniques and purpose of genetic maps
  • The history of sequencing the human genome and
    its future potential
  • The primary study and tools of the field of
    bioinformatics
  • The relationship between the genome and the
    proteome and exome
  • Concerns about ownership and genomes

3
Advancing Genetic Knowledge
  • Mutations have always been a major foundation for
    understanding genetics
  • Without mutations we would all be identical!
  • Before genetic sequencing, before even DNA,
    mutations were used to track relationship between
    genes

4
Chromosomal Linkage
  • A chromosome with two defects will create
    both-or-neither inheritance
  • Recall this is chromosomal linkage
  • All genes on X chromosome are linked
  • Hemophilia and colorblindness showed linkage
  • Autosomal linkage took much longer to find

5
Chromosomal Linkage
  • Nail-Patella Syndrome and Blood Type were finally
    linked
  • We now know they are both on chromosome 9
  • However, linkage was not total
  • Remember crossing over? AKA Chromosomal
    recombination

6
Crossing Over
  • Recall during meiosis (Prophase I) chromosomes
    will exchange DNA
  • This enables us to track what genes are on what
    chromosome
  • And where!

7
Chromosomal Linkage
8
Chromosomal Distance
  • The closer two genes are on a chromosome, the
    more frequently they will cross over together
  • The farther away they are, the more one will
    recombine without the other
  • Percentage of recombination measured in units of
    centimorgans
  • 2/16 12.5 12.5 centimorgans distance

9
Genetic Cloning
  • Thanks to PCR and improved DNA sequencing, many
    genes were mapped to chromosomes starting in the
    1980s
  • Huntington's, Cystic Fibrosis, Retinoblastoma,
    etc
  • The Human Genome Project was initiated in 1990

10
Human Genome Project
  • Goal Seq uence entirety of human genome
  • Additional goal figure out what genes do what
  • Additional goal sequence other animals/plants
  • Work got faster and faster as time went on
  • Computers were created that could accelerate the
    project

11
DNA Sequencing
  • Human genome is 3.2 billion DNA bases
  • Not the largest, not even close!
  • Marbled lungfish genome 132.8 billion DNA bases
  • That is NOT a typo!
  • Sequencing entire genome took a long time!

12
History of Human Genome Project
13
Sequencing Methods
  • Map-based sequencing locates sequences of DNA
    relative to markers found on each chromosome
  • A comprehensive map of which genes are on which
    chromosome can be constructed and measured in
    centimorgans
  • Whole genome sequencing slices the entire genome
    into cloned libraries then sequences them all
    using computer technology

14
Sequencing Methods
15
Genome Sequencing
  • Entirety of genome can now be sequenced in days
    instead of years
  • Still expensive but getting cheaper!
  • The human genome is 98 noncoding
  • The coding portion of the human genome is called
    the exome

16
Genome vs. Exome
  • Exome is the coding portions of DNA only
  • Codes for proteins
  • A scan of all exons in genome
  • 50 times less data to analyze
  • Used to screen and diagnose for genetic disorders
  • May not catch CNV disorders

17
Now What?
  • Once you have a genome, what do you do with it?
  • The field of bioinformatics addresses what to do
    with this massive amount of data
  • Bioinformaticians must be skilled in computer
    science and math (linear algebra and probability)

18
Bioinformatics Specialties
  • Comparative Genomics
  • Studying relationship between different
    animals/plants/bacteria
  • Structural Genomics
  • Studying structure of proteins produced by genes
  • Pharmacogenomics
  • How to make drugs to repair diseases

19
Bioinformatics Basics
  • The most important skill in bioinformatics
    locating a gene!
  • Find the gene in the following sequence
  • ACAGGAGAAATATACCAATACCGCTTGCGAGAGATCATGGAATCTCGAGC
    GTTATGTGAATGCTGAAAAAAAAAAA
  • A bioinformatician can find it!
  • Technically the entire sequence is a gene but the
    bioinformatician can find the start codon and the
    upstream promoter region
  • Technically the bioinformatician can write a
    computer program to do that for him/her

20
Gene Location
  • By homing in on clues like the TATA box and CCAAT
    initiator sequence, bioinformaticians can locate
    genes
  • This is known as annotation
  • Must be compared to protein sequences to have
    introns identified

21
Annotation
22
Introns and Exons
  • The codons (beginning with ATG) form an open
    reading frame (ORF)
  • The origin of the term frameshift
  • Insertion/deletion mutations may alter the
    frameshift unless they occur in an intron
  • Intron variability is much higher than exons!
  • Computers can detect all these predictable
    patterns

23
Genes in Genome
24
Full Genome
  • Remember that standard genes comprise only 2 of
    the genome, tops
  • Long stretches of DNA are repeated sequences that
    still serve important functions!
  • Alterations to these repeated stretches in one
    spot are called single nucleotide polymorphisms

25
Junk DNA Alterations
  • Single base changes (SNPs) can be compiled into a
    haplotype
  • Similar to a bar code of the chromosome
  • Reveals where the chromosome was inherited from
    and who else have a closely related chromosome
  • Changes to the number of repeated bases are
    called copy number variants

26
Copy Number Variants
  • CNVs alter the length of a chromosome
  • Since DNA can affect expression of genes
    thousands of bases away, CNVs are linked to
    various disorders
  • Probably due to variable or reduced expression of
    the associated gene/protein

27
Genome vs. Proteome
  • Even though there are only 25,000 genes, there
    are over 200,000 proteins
  • Possibly up to a million!!
  • Due to differential intron/exon splicing
  • All the proteins in the body together make the
    proteome
  • Studying proteins is called proteomics

28
Concerns of Genomics
  • Major concern who owns your genome?
  • Remember, now genes CANNOT be patented
  • Research still belongs to company even if it's
    done with your tissue
  • Major concern should we be testing genomes of
    healthy people?
  • Especially while information is incomplete!

29
Happy Wednesday!
Write a Comment
User Comments (0)
About PowerShow.com