MODERN GENETICS - PowerPoint PPT Presentation

Loading...

PPT – MODERN GENETICS PowerPoint presentation | free to download - id: 693f4d-M2JjZ



Loading


The Adobe Flash plugin is needed to view this content

Get the plugin now

View by Category
About This Presentation
Title:

MODERN GENETICS

Description:

Give two examples of vectors: ... Steps to Genetic Engineering How is a gene removed from a genome? How is the gene of interest separated from other genes? – PowerPoint PPT presentation

Number of Views:42
Avg rating:3.0/5.0
Slides: 39
Provided by: JTaylor8
Category:

less

Write a Comment
User Comments (0)
Transcript and Presenter's Notes

Title: MODERN GENETICS


1
MODERN GENETICS
2
What is Cloning?
  • Making an exact genetic copy of a cell, organ or
    an organism
  • This process uses SOMATIC CELLS (non-sex cells)
    instead of sex cells because somatic cells
    contain a complete set of chromosomes (46).

3
Basics of the Cloning Procedure Somatic Cell
Nuclear Transfer
  • This happens in vitro (outside the body).
  • The nucleus of a somatic cell is placed inside an
    egg cell that has had its nucleus removed.
  • Electricity sparks cell division of the egg cell
    and an embryo is formed.

4
Basics of the Cloning Procedure
  • An embryo is the form of the organism in its
    early stages. It is a group of undifferentiated
    cells.
  • The embryo is placed in the uterus of the egg
    donor or surrogate mother.
  • A surrogate mother is a female who carries the
    baby for another female.

5
Lets Draw the Cloning Process!
6
HISTORY OF CLONING
  • 1953 frog
  • 1996 sheep
  • 1998 cow
  • 2001 rabbit
  • 2002 rat
  • 2002 cat
  • 2003 horse
  • 2005 dog

7
(No Transcript)
8
Cloning does not always produce expected results.
It is also expensive and inefficient!
  • CC the cat cost 50,000 to create. Her genetics
    were the same as her clone, however she did not
    appear identical! Why?
  • Horse- 841 attempts .12 efficiency
  • Sheep- 277 attempts .36 efficiency

9
Rainbow- Parent Clone
CC- Copy Cat
10
Cloning Pros/Cons
  • Pros
  • Cons
  • Can clone organs for transplant patients.
  • Can help infertile couples have offspring
    genetically linked to one of the parents.
  • Can increase populations of endangered species.
  • Can bring back a deceased pet.
  • Can replicate living things with desirable
    traits- like trees that grow quickly.
  • Does not help to improve the genetic diversity of
    a species.
  • Could create a black market for transplant
    organs-Create clones to harvest organs!
  • Expensive and inefficient!

11
STEM CELL RESEARCH
  • What is a stem cell?
  • A cell that is not yet differentiated into a
    specific type.
  • Whats so special about embryonic stem cells?
  • They are Pluripotent
  • can become any of the 220 different cell types

12
Why is the use of embryonic stem cells so
controversial?
  • Removing a stem cell from an embryo for
    experimentation destroys the embryo.
  • Is this murder?
  • When does life begin?
  • Read and discuss Embryos R Us Case Study

13
Therapeutic potential
  • Turn the stem cells into
  • Pancreas cells to produce insulin to relieve
    diabetes
  • Dopamine producing cells in the brain to relieve
    Parkinsons disease
  • New limbs and failing organs

14
Is it controversial to experiment on all stem
cells?
  • In addition to embryonic stem cells, there are
    adult stem cells.
  • Adult stem cells are found in many organs and
    tissues, including brain, bone marrow, blood and
    skin.
  • These stem cells are multipotent which means they
    can only become a certain type of cell(s) .
  • Their purpose is to maintain and repair the
    tissue in which they are found.

15
Is it controversial to experiment on all stem
cells?
  • Experimenting with adult stem cells is not
    controversial because it does not harm the adult
    if the cells are removed from the body.
  • There has been some exciting recent research that
    has demonstrated the ability to turn adult stem
    cells into embryo-like stem cells. These are
    called induced pluripotent stem cells (IPSCs).

16
(No Transcript)
17
Genetic Engineering
  • gene- DNA sequence that codes for a protein.
  • AATCGTAACCGGTTA
  • genome -all the possible bases in a species or
    individual
  • Human Genome Project (1990-2003) - All of the
    base pairs in the human genome have been
    sequenced (locations of genes on the 23
    chromosomes have been determined). The human
    genome has approximately 20, 500 genes.

18
What is Genetic Engineering?
  • The modification of the DNA in an organism or the
    exchange of DNA between organisms.
  • Why would we want to do this?
  • Genetic engineering can happen between different
    species because the DNA code is universal. All
    living things have ACGT nucleotides and the same
    amino acid coding scheme.
  • AUG codes for methionine in all living things!

19
Steps to Genetic Engineering
  • 1. A gene of interest is removed from a genome.
  • 2. The gene is attached to a vector
    (transporter) and delivered into a host cell
  • 3. The host cell is put into a nutrient medium
    and allowed to divide many times to create many
    copies of the gene.
  • 4. The host cell is inserted into the organism.

20
How is a gene removed from a genome?
  • Restriction enzymes- recognize a specific DNA
    sequence and cut the DNA wherever that sequence
    exists.

ATCGGATGAATTCTACCGATTAAG TAGCCATCTTAAGATGGCTAATTC
21
How is the gene of interest separated from other
genes?
  • Gel electrophoresis

22
Gel Elecrophoresis
  • DNA samples are placed in a porous gel which is
    connected to an electric current.
  • The current moves the DNA pieces and separates
    them based on their size. The smallest pieces
    move the fastest and end up at the bottom.
  • We can use this technique to isolate genes,
    determine genetic relationships (paternity),
    determine evolutionary relationships, and solve
    crimes.

23
What is a common vector used in genetic
engineering?
  • Plasmids are circular DNA molecules found in
    bacteria that are often used for genetic
    engineering.
  • The plasmid is cut with the same restriction
    enzyme used to cut out the gene of interest.
  • Once the plasmid has the new gene, it is called
    recombinant DNA.

24
(No Transcript)
25
(No Transcript)
26
(No Transcript)
27
(No Transcript)
28
Gene Therapy
  • Humans can be genetically engineered.
  • Normal genes can be inserted into cells
    containing defective genes in order to correct
    genetic disorders.

29
Gene Therapy
30
Paternity Testing
  • If there is uncertainty about a childs
    biological father, DNA samples from the possible
    fathers can be compared with the DNA of the child
    and mother.
  • All DNA samples are treated with the same
    restriction enzyme and are run on a gel by
    electrophoresis.
  • A childs DNA pieces are a combination of pieces
    from the mother and father (each DNA band must
    match a band from one parent).

31
DNA Fingerprinting to determine Paternity
32
(No Transcript)
33
  • Who is the father?
  • Circle the smallest DNA fragment(s).
  • Box the largest DNA fragment(s).

34
Afather Bmother Are C and D both biological
children of A and B?
35
Genetics Technology Bingo
  • 1. Cloning
  • 2. Induced pluripotent stem cells
  • 3. Embryo
  • 4. Multipotent
  • 5. Surrogate
  • 6. Technology
  • 7. Gel electrophoresis
  • 8. Plasmid
  • 9. Adult stem cell
  • 10. Genetic engineering
  • 11. Electricity
  • 12. Restriction enzyme
  • 13. Gene therapy
  • 14. Genome
  • 15. Gene
  • 16. Recombinant DNA
  • 17. In vitro
  • 18. Somatic cell
  • 19. Somatic cell nuclear transfer
  • 20. Vector
  • 21. Uterus
  • 22. X-inactivation
  • 23. Embryonic stem cell
  • 24. Pluripotent

36
  • Biotechnology Test Review Questions
  • Easy
  • Small, circular piece of bacterial DNA is called
    a ____.
  • Give two examples of vectors
  • The entire collection of genes within human cells
    is called the _______________.
  • Difference between technology and biotechnology?
  • Function of restriction enzymes?
  • HGP stands for? How many base pairs in HG? How
    many proteins?
  • Difference between surrogate and biological
    mother?
  • A _____________ is caused by a defective or
    mutant gene.
  • Define gene.
  • The first cell created by sexual reproduction is
    called a

37
  • Medium
  • 1. Inserting unrelated pieces of DNA together
    will result in ____________________.
  • 2. IVF stands for? What is a synonym used for
    IVF?
  • 3. What does transgenic mean?
  • 4. Idenical twins are considered to be genetic
    ___________.
  • 5. How does IVF work? What does the female have
    to do? What does the male have to do?
  • 6. Why does IVF sometimes result in twins,
    triplets, or quads?
  • 7. Difference between fraternal vs. identical
    twins?
  • 8. How does Gel Electrophoresis separate DNA
    fragments?
  • 9. What is an example of a genetic disease?
  • 10. What kind of ethical questions arise from
    IVF?

38
  • Difficult
  • What is the difference between gene therapy and
    genetic engineering?
  • Difference between a hybrid and chimera?
  • Steps of genetic engineering?
  • The Hind R1 restriction enzyme is used to slice
    DNA at the GAATTC between the G and A.
    Illustrate how this enzyme would precisely cut
    the fragment
  • ATTAGATCGCCCTAGAATTCAAGCTGGTAGCTAGCTACATCTA
  • TAATCTAGAGGGATCTTAAGTTCGACCATCGATCGATGTAGAT
  • What research can be done using gel
    electrophoresis?
About PowerShow.com