Next Steps for Adolescent and Young Adult Oncology Basic Biology September 16-17, 2013 - PowerPoint PPT Presentation

1 / 37
About This Presentation
Title:

Next Steps for Adolescent and Young Adult Oncology Basic Biology September 16-17, 2013

Description:

Next Steps for Adolescent and Young Adult Oncology Basic Biology September 16-17, 2013 * * * * * * * * * * * * Purple lines represent tail-to-head junction, green ... – PowerPoint PPT presentation

Number of Views:277
Avg rating:3.0/5.0
Slides: 38
Provided by: Christopher330
Category:

less

Transcript and Presenter's Notes

Title: Next Steps for Adolescent and Young Adult Oncology Basic Biology September 16-17, 2013


1
Next Steps for Adolescent and Young Adult
OncologyBasic BiologySeptember 16-17, 2013
2
BBWG Members
  • Cary Anders Charles Mullighan
  • Donald Blair Nita Seibel
  • Archie Bleyer Beverly Teicher
  • Lisa Boardman Magdalena Thurin
  • Brandon Hayes-Lattin James Tricoli
  • Javed Khan Cheryl Willman
  • Sivaani Kummar
  • Stephen Hunger
  • Melinda Merchant

3
Science 317 1160, 2007
4
AYA Survival Disparities
  • Acute Lymphocytic Leukemia
  • Children have an 80 cure rate
  • Teenagers and young adults have a five year
    survival rate of only 50
  • Ewings Sarcoma
  • Five year survival rate
  • lt10 years old 70
  • 10-17 years old 60
  • gt18 years old 44

5
Explanation for this Phenomenon
  • Low enrollment for this age group in clinical
    trials
  • 30-50 of child cancer patients participate
  • 1-2 of AYA cancer patients participate
  • Distinctive biology for these patients and their
    tumors
  • Developmental and hormonal differences

6
History
  • NCI Progress Review Group report on AYA Cancers,
    2006 (NCI and Lance Armstrong Foundation)
  • NCI Adolescent and Young Adult Oncology (AYAO)
    working group formed in 2006
  • NCI/Lance Armstrong Foundation AYA Cancers
    Workshop, June 9 and 10, 2009
  • Publication of the AYA Workshop paper Unique
    Characteristics of Adolescent and Young Adult
    Acute Lymphoblastic Leukemia, Breast Cancer, and
    Colon Cancer JNCI 103 628-635, 2011

7
What is known about the incidence, outcome and
molecular characterization according to patient
age of CRC in the AYAO age group?
  • Comprise 2-6 of total annual colorectal cancer
    (CRC) cases
  • Approximately 800 deaths annually
  • Poorer prognosis and more aggressive disease than
    in adults
  • Greater frequency of the following than in adult
    CRC
  • Mucinous and signet ring histology
  • Microsatellite instability high (MSI-H)
  • Mutations in Mis-match repair (MMR) genes
  • Lower frequency of the following than in adult
    CRC
  • K-ras mutations, 17p and 18q LOH
  • Lower p53 protein levels than found in adult CRC

8
Are there current studies investigating the
molecular characterization of this tumor type in
the AYAO age group?
  • Hill et al., Journal Clinical Oncology, 2007
  • 77 CRC patients age 7-20 (St. Jude Childrens)
  • 48/77 (62) displayed mucinous histology
  • 34/48 (71) displayed signet ring histology
    (11-13 in adult CRC)
  • Did significantly more poorly than adult CRC
    patients despite being on adult protocols
  • Liu et al., Nature Medicine,1995
  • 189 CRC patients with no evidence of HNPCC
    analyzed using 4-5 microsatellite markers per
    tumor (Johns Hopkins)
  • 31 patients were 35 or younger
  • 18 (58) displayed MSI
  • 46 patients were 36-55
  • 8 (17) displayed MSI
  • 112 patients were 55 or older
  • 11 (10) displayed MSI

9
What are the current studies ongoing in older or
younger age groups that would provide further
insight into the biology of this tumor?
  • The Cancer Genome Anatomy (TCGA) project has
    provided data on genes that are frequently
    mutated in adult CRC
  • TCGA has identified several genes that exhibit
    amplification and elevated expression in adult
    CRC, including IGF-2
  • There are also consensus gene sets that exhibit
    mutations in adult CRC that have been identified
    (Vogelstein)

10
Clinical Questions
  • What contributes to the more aggressive clinical
    nature of AYA CRC tumors?
  • How can we better predict disease response in
    this group of patients?
  • What are the underlying reasons for the poor
    therapeutic response in this group of patients?

11
Scientific Questions
  • Why such a high frequency of MSI in the AYA
    group?
  • Hypermethylation of hMLH1 gene known to occur
  • What about other MMR genes?
  • What are the molecular reasons for poorer outcome
    for MSI-H patients in the AYA group?
  • What is the reason for the high frequency of the
    mucinous phenotype in the AYA group?
  • Why the difference in p53, K-ras and DCC
    characteristics in the AYA group?

12
Breast Cancer in the AYA Population
13
What is known about the incidence, outcome and
molecular characterization according to patient
age of Breast Cancer in the AYAO age group?
  • Breast cancer is the most frequent cancer in
    women in the AYA population
  • 1 in 200 AYA women will develop breast cancer
  • The disease is more likely to be aggressive, and
    to exhibit a triple negative, basel-cell
    phenotype
  • It often presents at a higher grade with a poorer
    prognosis
  • Molecular studies suggesting a novel gene
    expression pattern in AYA breast cancers have
    been controversial

14
Are there current studies investigating the
molecular characterization of this tumor type in
the AYAO age group?
  • Differential gene expression studies have
    investigated whether there is a unique pattern
    for AYA breast tumors in comparison to older
    women, but the results are conflicting and
    controversial Anders et al, J. Clin. Oncol
    2011,29e18-e20 Azim Jr. et al, 2012 Clin Ca
    Res, 2012 1341-1351 Servant et. al. 2012 Clin Ca
    Res 1704-1715 Colleoni and Anders, the
    Oncologist 2013, 18e13-15
  • Studies suggest an association between germline
    TP53 mutations and early onset HER2-positive
    breast cancer, which could lead to elucidation of
    molecular pathways involved in breast cancer
    Cancer 2012, 118(4) 908913 Rath et al Breast
    Ca Res Treat 2013 139(1)193-198
  • BRCA mutations have been linked to susceptibility
    and early onset of breast cancer Infante et al.
    Breast Ca Res 2010 122(2)567-571, Andres et al
    Clin Transl Onc, 2013, 10.1007/s12094-013-1070-9,

15
Clinical Questions
  • Do women in the AYA population show different
  • responses to therapy than older patients
    despite the
  • fact that the biology of the tumor itself
    appears to be
  • similar?
  • Can the response of AYA patients to current
    therapies
  • inform us about underlying mechanisms in this
  • population
  • Can we identify a biological basis for the
    apparent
  • greater tendency for AYA breast tumors to
  • metastasize independent of the greater
    number of
  • more aggressive tumors in this population?

16
Scientific Questions
  • Are there genetic susceptibility patterns that
    can be identified as being associated with the
    early onset of breast cancer independent of tumor
    type?
  • Is there a biological mechanism underlying the
    recent report suggesting that the incidence of
    advanced breast cancer in the AYA population has
    increased? Johnson et al, 2013 JAMA 309
    800-805
  • What mechanistic role does obestity play in early
    onset breast cancer?
  • Do AYA tumors show differences in tumor
    microenvironment that promote the development of
    more aggressive tumor types?
  • Are factors such as metabolism and micro-RNA
    different in AYA as compared to older patients,
    and can these factors be linked to tumor
    aggressiveness and poor therapeutic responses?

17
Next Steps for Adolescent and Young Adult
OncologyBasic Biology-MelanomaSeptember 16-17,
2013
18
BBWG Members
  • Magdalena Thurin
  • Melinda Merchant
  • Brandon Hayes-Lattin

19
AYA Melanoma
  • Melanoma is the 3d most common cancer diagnosed
    and the most lethal form of skin cancer among
    adolescents and young adults (aged 15-39 years)
    in the US.
  • The 5-year OS is 65 for regional and 15 distant
    metastatic site.
  • Melanoma incidence is higher among females
    compared with males.
  • Melanoma of the trunk are overrepresented in this
    age group.
  • Accuracy of melanoma cases reporting is limited
    because of incompleteness or nonspecific
    reporting including large proportion of
    unspecified histology.
  • Known risk factors
  • Adolescents and young adults appear to be at
    particular risk for developing melanoma because
    of UV exposure early in life.
  • Giant congenital nevi, neurocuataneous melanosis,
    xeroderma pigmentosum, Werner syndrome,
    retinoblastoma and immunosupression.
  • Transplant or chemotherapy for primary tumors.
  • Higher number of melanocytic nevigt 2mm in
    diameter.
  • Fair complexion, facial freckling, and family
    history of melanoma.
  • Understanding risk factors in AYA group is
    important to develop cancer control activities
    aimed at reducing melanoma incidence and death in
    this age group.

20
 Biopathology of melanoma in the AYA population
  • The biopathology of melanoma have been the
    subject of controversy because of inability to
    distinguish conventional melanomas from a
    subgroup of melanocytic neoplasms with Spitz
    nevus-like morphology commonly seen in AYA
    patients.
  • Pathologically, these melanocytic lesions have
    spindle and epithelioid cell cytology, exhibit
    epithelial hyperplasia, giant melanocytes at the
    dermo-epithelial junction, various degree of
    pagetoid spread in the epidermis, Kamino bodies
    and others.
  • The outcome of melanoma in the younger, as
    compared to the older populations has been shown
    to differ substantially
  • Metastases to sentinel nodes (SNL) are found more
    frequently in AYA groups with melanoma than would
    be expected in adults with the same stage of
    disease.
  • Melanoma in young patients is less likely to
    recur in distant organs.
  • Occurrence of more frequent LN metastases in
    young people suggests that melanoma cells in the
    young differ biologically and are more prone to
    progression and invasion.

21
Molecular studies
  • Comparative genomic hybridization (CGH)
    demonstrated multiple chromosomal aberrations in
    95 of the melanomas with spitzoid morphology
    whereas typical Spitz nevi did not reveal more
    than an isolated gain in the region of chromosome
    11 (11p).
  • The nevi that revealed an increase in 11p also
    showed frequent mutations in the gene encoding
    H-RAS (67).
  • Spitz nevi lack the BRAF mutations that are
    common in melanocytic nevi and melanomas.
  • CGH may be used to distinguish spitzoid melanoma
    from Spitz nevus when pathological features are
    in question but the value of assessing mutations
    in the BRAF, N-RAS and H-RAS genes is not
    established for melanocytic lesions in AYA
    patients.
  • Spitz nevi as a group show high levels of p16
    expression.
  • A group of miRNA-regulators of cell growth,
    proliferation, invasion, and survival that is
    differentially upregulated in younger patients
    melanomas compared to adults has been recently
    characterized. miRNA-337-5p appear to be involved
    in cell growth and migration and targets Lyn TK.
    cyclin-D-1, D3, A and CDK4 are target genes of
    miRNA-let-7b that is overexpressed in AYA
    melanoma.

22
Challenges
  • AYA participation rates in clinical trials are
    drastically lower than for pediatric patients and
    also lower than for adults.
  • Few trials have enough AYA participation to have
    the statistical power to allow analysis
    stratified by age.
  • AYA continue to be treated under guidelines
    created for older adults.
  • Lower rates of medical comorbidities and
    polypharmacy may permit AYAs to tolerate higher
    doses of anticancer therapy. Therapy can be
    optimized at the highest-dose treatment level
    such as high dose IL-2 and high dose interferon
    IFNa-2b.
  • Chemotherapy is poorly studied in this group.
  • The genetic and progression markers of melanoma
    in the young are likely also to differ from those
    in melanoma of elderly populations, but this has
    yet to be studied.
  • The different biology of melanoma in AYA
    population suggests that the outcomes for younger
    patients may be improved over those of adults but
    the outcomes need to be studied in clinical
    trials of adequate size and maturity, with
    stratification for age.

23
Sarcoma
  • From the Greek sarx meaning "flesh
  • Cancer that arises from transformed cells of
    mesenchymal origin.
  • Bone, cartilage, fat, muscle, vascular, neural
    supportive tissues, soft tissue, etc.
  • Molecularly and clinically heterogeneous group
    gt50 types rhabdomyosarcoma, Ewings sarcoma,
    osteosarcoma, chondrosarcoma, synovial,
    liposarcoma, desmoplastic small round-cell tumor,
    clear cell sarcoma, etc.
  • Incidence varies with age and diagnosis

24
Survival rate is lower for AYA with Ewings
sarcoma
Modified from Bleyer, A., Barr, R.,
Hayes-Lattin, B., Thomas, D., Ellis, C., and
Anderson, B. 2008. The distinctive biology of
cancer in adolescents and young adults. Nat Rev
Cancer 8288-298.
25
Sarcoma-BiologyMany driven by fusion
oncogenesFunction of most unknown
Transcriptional/Epigenetic Action
26
Sarcoma-BiologyChallenges and Opportunities
  • Fusion genes are drivers for many sarcomas
  • Ideal targets because not expressed in normal
    tissues
  • Likely that fusion genes alter signal
    transduction, cell cycle progression,
    transcriptional regulation and epigenetic
    modification. Heterogeneous group and function of
    majority of largely unknown.
  • Difficult to target fusion genes if their primary
    role transcriptional regulation. Basic science
    research is needed.
  • The other genomic alterations aside from fusion
    genes, are largely unknown. gt3000 tumor samples
    have been reported in sequencing studies 0 of
    them are AYA Sarcoma
  • Metastatic AYA sarcomas difficult to treat,
    largely chemo- insensitive.
  • Difference between AYA and childhood sarcomas
    unknown
  • Lack of animal models for AYA sarcoma

27
Current studies investigating the molecular
characterization of this tumor type in the AYAO
age group
  • Individual laboratories including the NCIs
    intramural program are performing next generation
    sequencing of Rhabdomyosarcoma, Osteosarcoma
    (largely pediatric)
  • NCI has completed a screen for a direct inhibitor
    of the EWS-FLI1 transcription factor
  • NCI is launching a screen for a direct inhibitor
    of the PAX3-FOXO1 transcription factor.
  • NCI trial NCT01109394 enrolls AYA patients for
    comprhensive Omics studies
  • NCI trial Cediranib, in patients with ASPS
    demonstrated an overall response rate of 35 with
    a disease control rate of 84 at 24 weeks.

28
Are there specific molecular targets in this
tumor type in AYAO patients that make it more
vulnerable to specific therapeutic treatments.
  • PARP-1 inhibition trials in EWS underway.
  • Mithramycin was found to directly inhibit the
    EWS-FLI1 transcription factor scrreeing by high
    throughput NCI trial open.
  • EWS-FLI1 fusion gene requires binding to RNA
    helicase A for oncogenic function. Strategies to
    inhibit interaction with RNA helicase A are
    underway.
  • Novel agents targeting the MET and VEGFR therapy
    pathway for tumors (ASPS) carrying the ASPL-TFE-3
    fusion transcript e.g. a trial with
    caboxantinib, a dual inhibitor of VEGFR and MET,
    in these patients is underway NCT01755195.

29
Massively Parallel Sequencing (Next-Generation
Sequencing)
Genomic DNA or RNA
Fragmentation
Fragment
Size Selection
DNA Fragments of Similar Sizes
Adaptors Ligation
Genomic DNA Library
Amplification and Sequencing
Align (Map) Reads to Ref. Genome
Ref. Genome
Genome Sequence
AGCTGCTCGTCGCGAAACTCCGATCGACTGCTGATCGACTCGATCACTCG
ATCGTAGTCGAGAGTACTCGATGCT
30
Genomic Landscape of AYA SarcomasWhat is known?
?
gt3000 tumor samples have been reported in next
generation sequencing studies 0 of them are for
AYA Sarcoma
31
Genomic Approaches for the Comprehensive Analysis
of the AYA Cancer Genome- Catalog ALL the
Changes in the Genome
Tumor
Germ line
32
Mutation rate across cancers-Dont forget germ
line
33
Next Generation Sequencing of Rhabdomyosarcoma
(RMS) Fusion Positive RMS Have Lower Somatic
Mutations Rate
  • Implications
  • Fusion Gene is the Driver
  • Other Driver Mutations in fusion negative sarcoma

34
ARMS by histology, no PAX3/7-FOXO1 fusion
detected, low mutation rate
35
Fusion Negative ARMS Shows massive 2q
Rearrangement with in-Frame PAX3-INO80D
Purpletail-to-head Green head-to-tail junction
(possibly tandem duplication) Orange
tail-to-tail junction or head-to-head junction
(inversion)
36
RNAseq Confirms Expression of PAX3-INO80D Novel
Fusion Transcript
37
SarcomaFuture Directions
  • Rare heterogeneous tumors, small numbers,
    requires a national/international strategy
  • Tumor bank that systematically collects blood,
    serum, plasma, fresh frozen tumor and FFPE
    tissues with clinical information database is
    required.
  • Next generation sequencing project and other
    Omics studies should be undertaken to catalog
    all genomic changes begin with exome and
    transcriptome
  • Biological function of fusion genes
  • Direct inhibitor of the fusion genes
  • Novel drugs/therapeutic strategies
Write a Comment
User Comments (0)
About PowerShow.com