Next Steps for Adolescent and Young Adult Oncology Basic Biology September 16-17, 2013

1
Next Steps for Adolescent and Young Adult
OncologyBasic BiologySeptember 16-17, 2013
2
BBWG Members

• Cary Anders Charles Mullighan
• Donald Blair Nita Seibel
• Archie Bleyer Beverly Teicher
• Lisa Boardman Magdalena Thurin
• Brandon Hayes-Lattin James Tricoli
• Javed Khan Cheryl Willman
• Sivaani Kummar
• Stephen Hunger
• Melinda Merchant

3
Science 317 1160, 2007
4
AYA Survival Disparities

• Acute Lymphocytic Leukemia
• Children have an 80 cure rate
• Teenagers and young adults have a five year
  survival rate of only 50
• Ewings Sarcoma
• Five year survival rate
• lt10 years old 70
• 10-17 years old 60
• gt18 years old 44

5
Explanation for this Phenomenon

• Low enrollment for this age group in clinical
  trials
• 30-50 of child cancer patients participate
• 1-2 of AYA cancer patients participate
• Distinctive biology for these patients and their
  tumors
• Developmental and hormonal differences

6
History

• NCI Progress Review Group report on AYA Cancers,
  2006 (NCI and Lance Armstrong Foundation)
• NCI Adolescent and Young Adult Oncology (AYAO)
  working group formed in 2006
• NCI/Lance Armstrong Foundation AYA Cancers
  Workshop, June 9 and 10, 2009
• Publication of the AYA Workshop paper Unique
  Characteristics of Adolescent and Young Adult
  Acute Lymphoblastic Leukemia, Breast Cancer, and
  Colon Cancer JNCI 103 628-635, 2011

7
What is known about the incidence, outcome and
molecular characterization according to patient
age of CRC in the AYAO age group?

• Comprise 2-6 of total annual colorectal cancer
  (CRC) cases
• Approximately 800 deaths annually
• Poorer prognosis and more aggressive disease than
  in adults
• Greater frequency of the following than in adult
  CRC
• Mucinous and signet ring histology
• Microsatellite instability high (MSI-H)
• Mutations in Mis-match repair (MMR) genes
• Lower frequency of the following than in adult
  CRC
• K-ras mutations, 17p and 18q LOH
• Lower p53 protein levels than found in adult CRC

8
Are there current studies investigating the
molecular characterization of this tumor type in
the AYAO age group?

• Hill et al., Journal Clinical Oncology, 2007
• 77 CRC patients age 7-20 (St. Jude Childrens)
• 48/77 (62) displayed mucinous histology
• 34/48 (71) displayed signet ring histology
  (11-13 in adult CRC)
• Did significantly more poorly than adult CRC
  patients despite being on adult protocols
• Liu et al., Nature Medicine,1995
• 189 CRC patients with no evidence of HNPCC
  analyzed using 4-5 microsatellite markers per
  tumor (Johns Hopkins)
• 31 patients were 35 or younger
• 18 (58) displayed MSI
• 46 patients were 36-55
• 8 (17) displayed MSI
• 112 patients were 55 or older
• 11 (10) displayed MSI

9
What are the current studies ongoing in older or
younger age groups that would provide further
insight into the biology of this tumor?

• The Cancer Genome Anatomy (TCGA) project has
  provided data on genes that are frequently
  mutated in adult CRC
• TCGA has identified several genes that exhibit
  amplification and elevated expression in adult
  CRC, including IGF-2
• There are also consensus gene sets that exhibit
  mutations in adult CRC that have been identified
  (Vogelstein)

10
Clinical Questions

• What contributes to the more aggressive clinical
  nature of AYA CRC tumors?
• How can we better predict disease response in
  this group of patients?
• What are the underlying reasons for the poor
  therapeutic response in this group of patients?

11
Scientific Questions

• Why such a high frequency of MSI in the AYA
  group?
• Hypermethylation of hMLH1 gene known to occur
• What about other MMR genes?
• What are the molecular reasons for poorer outcome
  for MSI-H patients in the AYA group?
• What is the reason for the high frequency of the
  mucinous phenotype in the AYA group?
• Why the difference in p53, K-ras and DCC
  characteristics in the AYA group?

12
Breast Cancer in the AYA Population
13
What is known about the incidence, outcome and
molecular characterization according to patient
age of Breast Cancer in the AYAO age group?

• Breast cancer is the most frequent cancer in
  women in the AYA population
• 1 in 200 AYA women will develop breast cancer
• The disease is more likely to be aggressive, and
  to exhibit a triple negative, basel-cell
  phenotype
• It often presents at a higher grade with a poorer
  prognosis
• Molecular studies suggesting a novel gene
  expression pattern in AYA breast cancers have
  been controversial

14
Are there current studies investigating the
molecular characterization of this tumor type in
the AYAO age group?

• Differential gene expression studies have
  investigated whether there is a unique pattern
  for AYA breast tumors in comparison to older
  women, but the results are conflicting and
  controversial Anders et al, J. Clin. Oncol
  2011,29e18-e20 Azim Jr. et al, 2012 Clin Ca
  Res, 2012 1341-1351 Servant et. al. 2012 Clin Ca
  Res 1704-1715 Colleoni and Anders, the
  Oncologist 2013, 18e13-15
• Studies suggest an association between germline
  TP53 mutations and early onset HER2-positive
  breast cancer, which could lead to elucidation of
  molecular pathways involved in breast cancer
  Cancer 2012, 118(4) 908913 Rath et al Breast
  Ca Res Treat 2013 139(1)193-198
• BRCA mutations have been linked to susceptibility
  and early onset of breast cancer Infante et al.
  Breast Ca Res 2010 122(2)567-571, Andres et al
  Clin Transl Onc, 2013, 10.1007/s12094-013-1070-9,
  

15
Clinical Questions

• Do women in the AYA population show different
  
• responses to therapy than older patients
  despite the
• fact that the biology of the tumor itself
  appears to be
• similar?
• Can the response of AYA patients to current
  therapies
• inform us about underlying mechanisms in this
  
• population
• Can we identify a biological basis for the
  apparent
• greater tendency for AYA breast tumors to
• metastasize independent of the greater
  number of
• more aggressive tumors in this population?

16
Scientific Questions

• Are there genetic susceptibility patterns that
  can be identified as being associated with the
  early onset of breast cancer independent of tumor
  type?
• Is there a biological mechanism underlying the
  recent report suggesting that the incidence of
  advanced breast cancer in the AYA population has
  increased? Johnson et al, 2013 JAMA 309
  800-805
• What mechanistic role does obestity play in early
  onset breast cancer?
• Do AYA tumors show differences in tumor
  microenvironment that promote the development of
  more aggressive tumor types?
• Are factors such as metabolism and micro-RNA
  different in AYA as compared to older patients,
  and can these factors be linked to tumor
  aggressiveness and poor therapeutic responses?

17
Next Steps for Adolescent and Young Adult
OncologyBasic Biology-MelanomaSeptember 16-17,
2013
18
BBWG Members

• Magdalena Thurin
• Melinda Merchant
• Brandon Hayes-Lattin

19
AYA Melanoma

• Melanoma is the 3d most common cancer diagnosed
  and the most lethal form of skin cancer among
  adolescents and young adults (aged 15-39 years)
  in the US.
• The 5-year OS is 65 for regional and 15 distant
  metastatic site.
• Melanoma incidence is higher among females
  compared with males.
• Melanoma of the trunk are overrepresented in this
  age group.
• Accuracy of melanoma cases reporting is limited
  because of incompleteness or nonspecific
  reporting including large proportion of
  unspecified histology.
• Known risk factors
• Adolescents and young adults appear to be at
  particular risk for developing melanoma because
  of UV exposure early in life.
• Giant congenital nevi, neurocuataneous melanosis,
  xeroderma pigmentosum, Werner syndrome,
  retinoblastoma and immunosupression.
• Transplant or chemotherapy for primary tumors.
• Higher number of melanocytic nevigt 2mm in
  diameter.
• Fair complexion, facial freckling, and family
  history of melanoma.
• Understanding risk factors in AYA group is
  important to develop cancer control activities
  aimed at reducing melanoma incidence and death in
  this age group.

20
 Biopathology of melanoma in the AYA population

• The biopathology of melanoma have been the
  subject of controversy because of inability to
  distinguish conventional melanomas from a
  subgroup of melanocytic neoplasms with Spitz
  nevus-like morphology commonly seen in AYA
  patients.
• Pathologically, these melanocytic lesions have
  spindle and epithelioid cell cytology, exhibit
  epithelial hyperplasia, giant melanocytes at the
  dermo-epithelial junction, various degree of
  pagetoid spread in the epidermis, Kamino bodies
  and others.
• The outcome of melanoma in the younger, as
  compared to the older populations has been shown
  to differ substantially
• Metastases to sentinel nodes (SNL) are found more
  frequently in AYA groups with melanoma than would
  be expected in adults with the same stage of
  disease.
• Melanoma in young patients is less likely to
  recur in distant organs.
• Occurrence of more frequent LN metastases in
  young people suggests that melanoma cells in the
  young differ biologically and are more prone to
  progression and invasion.

21
Molecular studies

• Comparative genomic hybridization (CGH)
  demonstrated multiple chromosomal aberrations in
  95 of the melanomas with spitzoid morphology
  whereas typical Spitz nevi did not reveal more
  than an isolated gain in the region of chromosome
  11 (11p).
• The nevi that revealed an increase in 11p also
  showed frequent mutations in the gene encoding
  H-RAS (67).
• Spitz nevi lack the BRAF mutations that are
  common in melanocytic nevi and melanomas.
• CGH may be used to distinguish spitzoid melanoma
  from Spitz nevus when pathological features are
  in question but the value of assessing mutations
  in the BRAF, N-RAS and H-RAS genes is not
  established for melanocytic lesions in AYA
  patients.
• Spitz nevi as a group show high levels of p16
  expression.
• A group of miRNA-regulators of cell growth,
  proliferation, invasion, and survival that is
  differentially upregulated in younger patients
  melanomas compared to adults has been recently
  characterized. miRNA-337-5p appear to be involved
  in cell growth and migration and targets Lyn TK.
  cyclin-D-1, D3, A and CDK4 are target genes of
  miRNA-let-7b that is overexpressed in AYA
  melanoma.

22
Challenges

• AYA participation rates in clinical trials are
  drastically lower than for pediatric patients and
  also lower than for adults.
• Few trials have enough AYA participation to have
  the statistical power to allow analysis
  stratified by age.
• AYA continue to be treated under guidelines
  created for older adults.
• Lower rates of medical comorbidities and
  polypharmacy may permit AYAs to tolerate higher
  doses of anticancer therapy. Therapy can be
  optimized at the highest-dose treatment level
  such as high dose IL-2 and high dose interferon
  IFNa-2b.
• Chemotherapy is poorly studied in this group.
• The genetic and progression markers of melanoma
  in the young are likely also to differ from those
  in melanoma of elderly populations, but this has
  yet to be studied.
• The different biology of melanoma in AYA
  population suggests that the outcomes for younger
  patients may be improved over those of adults but
  the outcomes need to be studied in clinical
  trials of adequate size and maturity, with
  stratification for age.

23
Sarcoma

• From the Greek sarx meaning "flesh
• Cancer that arises from transformed cells of
  mesenchymal origin.
• Bone, cartilage, fat, muscle, vascular, neural
  supportive tissues, soft tissue, etc.
• Molecularly and clinically heterogeneous group
  gt50 types rhabdomyosarcoma, Ewings sarcoma,
  osteosarcoma, chondrosarcoma, synovial,
  liposarcoma, desmoplastic small round-cell tumor,
  clear cell sarcoma, etc.
• Incidence varies with age and diagnosis

24
Survival rate is lower for AYA with Ewings
sarcoma
Modified from Bleyer, A., Barr, R.,
Hayes-Lattin, B., Thomas, D., Ellis, C., and
Anderson, B. 2008. The distinctive biology of
cancer in adolescents and young adults. Nat Rev
Cancer 8288-298.
25
Sarcoma-BiologyMany driven by fusion
oncogenesFunction of most unknown
Transcriptional/Epigenetic Action
26
Sarcoma-BiologyChallenges and Opportunities

• Fusion genes are drivers for many sarcomas
• Ideal targets because not expressed in normal
  tissues
• Likely that fusion genes alter signal
  transduction, cell cycle progression,
  transcriptional regulation and epigenetic
  modification. Heterogeneous group and function of
  majority of largely unknown.
• Difficult to target fusion genes if their primary
  role transcriptional regulation. Basic science
  research is needed.
• The other genomic alterations aside from fusion
  genes, are largely unknown. gt3000 tumor samples
  have been reported in sequencing studies 0 of
  them are AYA Sarcoma
• Metastatic AYA sarcomas difficult to treat,
  largely chemo- insensitive.
• Difference between AYA and childhood sarcomas
  unknown
• Lack of animal models for AYA sarcoma

27
Current studies investigating the molecular
characterization of this tumor type in the AYAO
age group

• Individual laboratories including the NCIs
  intramural program are performing next generation
  sequencing of Rhabdomyosarcoma, Osteosarcoma
  (largely pediatric)
• NCI has completed a screen for a direct inhibitor
  of the EWS-FLI1 transcription factor
• NCI is launching a screen for a direct inhibitor
  of the PAX3-FOXO1 transcription factor.
• NCI trial NCT01109394 enrolls AYA patients for
  comprhensive Omics studies
• NCI trial Cediranib, in patients with ASPS
  demonstrated an overall response rate of 35 with
  a disease control rate of 84 at 24 weeks.

28
Are there specific molecular targets in this
tumor type in AYAO patients that make it more
vulnerable to specific therapeutic treatments.

• PARP-1 inhibition trials in EWS underway.
• Mithramycin was found to directly inhibit the
  EWS-FLI1 transcription factor scrreeing by high
  throughput NCI trial open.
• EWS-FLI1 fusion gene requires binding to RNA
  helicase A for oncogenic function. Strategies to
  inhibit interaction with RNA helicase A are
  underway.
• Novel agents targeting the MET and VEGFR therapy
  pathway for tumors (ASPS) carrying the ASPL-TFE-3
  fusion transcript e.g. a trial with
  caboxantinib, a dual inhibitor of VEGFR and MET,
  in these patients is underway NCT01755195.

29
Massively Parallel Sequencing (Next-Generation
Sequencing)
Genomic DNA or RNA
Fragmentation
Fragment
Size Selection
DNA Fragments of Similar Sizes
Adaptors Ligation
Genomic DNA Library
Amplification and Sequencing
Align (Map) Reads to Ref. Genome
Ref. Genome
Genome Sequence
AGCTGCTCGTCGCGAAACTCCGATCGACTGCTGATCGACTCGATCACTCG
ATCGTAGTCGAGAGTACTCGATGCT
30
Genomic Landscape of AYA SarcomasWhat is known?
?
gt3000 tumor samples have been reported in next
generation sequencing studies 0 of them are for
AYA Sarcoma
31
Genomic Approaches for the Comprehensive Analysis
of the AYA Cancer Genome- Catalog ALL the
Changes in the Genome
Tumor
Germ line
32
Mutation rate across cancers-Dont forget germ
line
33
Next Generation Sequencing of Rhabdomyosarcoma
(RMS) Fusion Positive RMS Have Lower Somatic
Mutations Rate

• Implications
• Fusion Gene is the Driver
• Other Driver Mutations in fusion negative sarcoma

34
ARMS by histology, no PAX3/7-FOXO1 fusion
detected, low mutation rate
35
Fusion Negative ARMS Shows massive 2q
Rearrangement with in-Frame PAX3-INO80D
Purpletail-to-head Green head-to-tail junction
(possibly tandem duplication) Orange
tail-to-tail junction or head-to-head junction
(inversion)
36
RNAseq Confirms Expression of PAX3-INO80D Novel
Fusion Transcript
37
SarcomaFuture Directions

• Rare heterogeneous tumors, small numbers,
  requires a national/international strategy
• Tumor bank that systematically collects blood,
  serum, plasma, fresh frozen tumor and FFPE
  tissues with clinical information database is
  required.
• Next generation sequencing project and other
  Omics studies should be undertaken to catalog
  all genomic changes begin with exome and
  transcriptome
• Biological function of fusion genes
• Direct inhibitor of the fusion genes
• Novel drugs/therapeutic strategies