Title: Infectious disease screening of blood products for prevention of transfusion-transmitted diseases
1Infectious disease screening of blood products
for prevention of transfusion-transmitted diseases
- Roni J. Bollag
- October 2005
2 610.40 Test requirements. (a) Human blood and
blood components. Except as specified in
paragraphs (c) and (d) of this section, you, an
establishment that collects blood or
blood components, must test each donation of
human blood or blood component intended for use
in preparing a product, including donations
intended as a component of, or used to prepare, a
medical device, for evidence of infection due
to the following communicable disease agents (1)
Human immunodeficiency virus, type 1 (2) Human
immunodeficiency virus, type 2 (3) Hepatitis B
virus (4) Hepatitis C virus (5) Human
T-lymphotropic virus, type I and (6) Human
T-lymphotropic virus, type II.
(i) Syphilis testing. In addition to the testing
otherwise required under this section, you must
test by a serological test for syphilis under
640.5(a), 640.14, 640.23(a), 640.33(a),
640.53(a), and 640.65(b)(2) of this chapter.
PROPOSED 24th edition of Standards for Blood
Banks and Transfusion Services, for Comment
Purposes (10/7-12/7/05)
3Testing for transfusion-transmitted diseases
- HBsAg
- anti-HBc
- anti-HCV
- HCV RNA
- anti-HIV-1/2
- HIV-1 RNA
- anti-HTLV-I/II
- syphilis serology
- WNV RNA
4Historical perspective
- Pre-1985 syphilis, HBsAg
- 1985-1989 better HBsAg, HIV, HTLV,
- ALT, anti-HBc (surrogates for nonA, nonB Hep)
- 1990 added HCV, HIV-2, HTLV-II
- 1996 HIV p24 Ag testing
- 1999 HIV, HCV NAT
- 2004 WNV NAT
5Hepatitis B
- transmitted through parenteral, sexual
exposure - mean incubation time 90 days
- 50 of infections are symptomatic
- 1/500 infections are lethal
- 6 -10 of infections become chronic
- vaccination makes donor anti-HBs, HBsAg-,
anti-HBc- - risk of transmission 1/66,000
6Hepatitis C
- Transmitted through parenteral (common) or sexual
(rare) exposure - Most common chronic blood-borne infection in US
with 150,000 new cases/year. - 4 million infected in US
- Most common transfusion-transmitted disease
- Most common cause of liver transplants.
- 75 of infections become chronic
- Latency of symptomatic liver disease can be
decades - Antibody appears in serum 54 192 days
post-infection - Risk of transmission 1/103,000
7HIV
- First reports of transfusion-transmitted HIV in
1982 - Blood product testing began in 1985
- transmitted through parenteral, sexual exposure
- Variable latency period
- Antibody titer detectable 45 days
post-infection - Common symptoms include night sweats, weight
loss, diarrhea, thrush, purpura - Infection chronic, but viral load abated with
multi-drug therapy - Risk of transmission 1/563,000
8Transfusion transmission risks
1100
Transmission risk, per unit
HIV
11000
HBV
110 000
HCV
1100 000
11 000 000
1998
2000
1996
1994
1992
1990
1988
1986
1984
2002
9HTLV-I/II
- Transmitted through parenteral or sexual exposure
- HTLV-I endemic in Japan and the Caribbean
- Most infections generate only mild symptoms
- HTLV-1 causes adult T-cell leukemia/lymphoma
(0.1/year) - neurological disorder similar to MS (0.1/year)
- Risk of transmission 1/641,000.
10West Nile Virus
- transmitted by arthropod exposure (incidental)
- birds are primary hosts
- 50nm spherical, lipid-enveloped flavivirus
- Single-stranded positive sense RNA genome (11,000
nts) - Encephalitis, meningites
- Asymmetric flaccid paralysis (poliomyelitis-like)
- 2002 4156 cases reported in U.S. (284
fatalities) - 5-10 mortality
- Initial screening by questionnaire
- Voluntary NAT testing through 2004, 1017 units
withdrawn due to presumptive WNV infection - Peak exposure in August-September
- Viremia 6.5 to 56.4 days
11Syphilis
- The great imitator
- transmitted by sexual exposure
- rarely transmitted by transfusion (2-3 reports in
30 years) - seroconversion occurs after occurs after
spirochetemia - untreated infection progresses through multiple
stages - testing is required by AABB (past 50 years)
- syphilis positivity considered surrogate marker
for other diseases transmitted by high-risk
behaviors - RPR for cardiolipin or reagin (non-specific)
- Positive RPR sent for treponemal antibody testing
(specific)
12Misperception?
Syphilis is a venereal disease that can also be
acquired by exposure to infected blood. -
introduction to eMedicine article
http//www.emedicine.com/MED/topic2224.htm
13Trends in infectious disease
14Syphilis
15RPR (non-treponemal)
- Antigen
- 0.003 cardiolipin
- 0.02 lecithin
- 0.09 cholesterol
- 10 choline chloride
- 0.01875 charcoal
- specimen not heat-inactivated
- acceptable specimens serum, plasma, cord blood
- unacceptable specimen CSF
16VDRL (non-treponemal)
- Antigen
- 0.03 cardiolipin
- 0.2 lecithin
- 0.9 cholesterol
- specimen heat-inactivated
- acceptable specimens serum, CSF, cord blood
- unacceptable specimen plasma
17FTA-ABS (treponemal)
- Antigen
- suspension of Treponema pallidum (Nichols)
extracted from rabbit testicular tissue - Sorbent
- cultures of nonpathogenic Reiter treponemes
- Detection
- FITC-labeled rabbit antihuman IgG
18TP-PA MHA-TP (treponemal)
- Antigen
- formalinized tanned sheep erythrocytes sensitized
with T. pallidum (2.5 suspension) - Sorbent
- 0.5 sheep red cell membranes
- 0.25 bovine red cell membranes
- 0.1 rabbit testicular extract
- 0.125 sonicated Reiter treponeme
- 1 normal rabbit serum
- Detection
- Agglutination
19Sensitivities and Specificities of Syphilis
serology tests
Standard Status Nontreponemal Tests
Standard Status Treponemal Tests
20Causes of false positive non-treponemal tests
21Causes of false positive treponemal tests
22AABB position on syphilis testing
STATEMENT OF THE AMERICAN ASSOCIATION OF BLOOD
BANKSBEFORE THE BLOOD PRODUCTS ADVISORY
COMMITTEE September 15, 2000 Syphilis Testing
Presented by Louis Katz, MDChair, AABB
Transfusion Transmitted Disease Committee
AABB believes the requirement for performing an
STS on each whole blood donation can safely be
eliminated based on thirty years experience
23AABB position on syphilis testingRationale
- transfusion-transmitted syphilis not recognized
in US for 30 years - transmissibility of T. pallidum occurs before
the STS is reactive - storage of blood components in refrigerators
and improved oxygen tension likely to prevent
transmission of spirochetes - from 1990 to 1997, 57 of 241,800 component
recalls were for incorrect syphilis testing
24Serological vs NAT testing
- Window period (based on serological testing)
- HCV (80d)
- HBV (56 d)
- HIV (16 d)
- Window period (based on NAT)
- HCV (10-30 d)
- HIV (10 d)
http//www.moffitt.usf.edu/pubs/ccj/v6n5/dept5.htm
25Algorithm for multiplex NAT screening
26Syphilis NAT testing
- Published PCR targets
- tpf-1
- BMP
- tmpA, tmpB
- 47-kDa protein gene
- 16S RNA
- polA
- Sensitivity
- 200 organisms/ml
- gold-standard (RIT) detects 2 organisms/ml
27Proposal for Treponema pallidum diagnostic PCR
based on the highly conserved mutL gene
- Primers
- forward CTTGAAACGCAAATGCTCAA
- reverse CCCTCGCTTCCTAACACAAG
- PCR product 197 bp
- Rationale
- bacterial mutL homologs are conserved through
to humans and are essential for function
28Serology vs NAT testing for Treponema pallidum
- Window period for syphilis 1 3 wks
- NAT testing can identify 50 organisms (decreasing
window to less than 1 week). - The rabbit infectivity test (RIT), "gold
standard" test has a detection limit of a single
organism and can be used to confirm T. pallidum
infection - requires access to an animal facility
- extremely time-consuming and expensive
- Minimum TAT 90 d
29Problems with NAT testing for syphilis
- molecular biological expertise required
- special precautions to prevent cross-contamination
- commercially available NAT assays require more
than 12 hours to perform - the cost of each commercial NAT test is
approximately 10 times that of the most expensive
EIA test.
30Conclusion serological testing for syphilis in
blood products
- Serological testing for syphilis in individual
donated blood products should be eliminated or
replaced with highly specific and sensitive NAT
testing, to be performed in multiplex algorithm
with other NAT screens
31Bibliography
- Orton, S.L., Liu, H., Dodd, R.Y., Williams, A.E.
(2002) Prevalence of circulating Treponema
pallidum DNA and RNA in blood donors with
confirmed-positive syphilis tests.Transfusion.
42 94-99 - Palmer, H.M., Higgins, S.P., Herring, A.J.,
Kingston, M.A. (2003) Use of PCR in the diagnosis
of early syphilis in the United Kingdom. Sex.
Transm. Infect. 79 479-483. - Liu, H., Rodes, B., Chen, C.-Y., Steiner, B.
(2001) New tests for syphilis rational design of
a PCR method for detection of Treponema pallidum
in clinical specimens using unique regions of the
DNA polymerase I gene. J. Clin. Microbiol.
391941-1946 - Harmening, D.M. (2005) Modern Blood Banking and
Transfusion Practices, 5th ed. Philadelphia F.A.
Davis and Co. - Brecher, M.E., ed. (2002) AABB Technical Manual,
14th ed. Bethesda, MD American Association of
Blood Banks. - http//www.aabb.org/pressroom/press_releases/prbpa
csyph091400.htm - http//www.moffitt.usf.edu/pubs/ccj/v6n5/dept5.htm
- http//www.aabb.org/About_the_AABB/Stds_and_Accred
/stdsproposedbbts24.pdf - http//www.emedicine.com/MED/topic2224.htm
- http//www.bloodbook.com/trans-tran.html
- http//www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd
RetrievedbNucleotidelist_uids3322571doptGenB
ank -