Infectious disease screening of blood products for prevention of transfusion-transmitted diseases - PowerPoint PPT Presentation

Loading...

PPT – Infectious disease screening of blood products for prevention of transfusion-transmitted diseases PowerPoint presentation | free to view - id: 3f9fcc-ZTQ0O



Loading


The Adobe Flash plugin is needed to view this content

Get the plugin now

View by Category
About This Presentation
Title:

Infectious disease screening of blood products for prevention of transfusion-transmitted diseases

Description:

Infectious disease screening of blood products for prevention of transfusion-transmitted diseases Roni J. Bollag October 2005 Historical perspective Pre-1985 ... – PowerPoint PPT presentation

Number of Views:94
Avg rating:3.0/5.0
Slides: 32
Provided by: MCG73
Category:

less

Write a Comment
User Comments (0)
Transcript and Presenter's Notes

Title: Infectious disease screening of blood products for prevention of transfusion-transmitted diseases


1
Infectious disease screening of blood products
for prevention of transfusion-transmitted diseases
  • Roni J. Bollag
  • October 2005

2
610.40 Test requirements. (a) Human blood and
blood components. Except as specified in
paragraphs (c) and (d) of this section, you, an
establishment that collects blood or
blood components, must test each donation of
human blood or blood component intended for use
in preparing a product, including donations
intended as a component of, or used to prepare, a
medical device, for evidence of infection due
to the following communicable disease agents (1)
Human immunodeficiency virus, type 1 (2) Human
immunodeficiency virus, type 2 (3) Hepatitis B
virus (4) Hepatitis C virus (5) Human
T-lymphotropic virus, type I and (6) Human
T-lymphotropic virus, type II.
(i) Syphilis testing. In addition to the testing
otherwise required under this section, you must
test by a serological test for syphilis under
640.5(a), 640.14, 640.23(a), 640.33(a),
640.53(a), and 640.65(b)(2) of this chapter.
PROPOSED 24th edition of Standards for Blood
Banks and Transfusion Services, for Comment
Purposes (10/7-12/7/05)
3
Testing for transfusion-transmitted diseases
  • HBsAg
  • anti-HBc
  • anti-HCV
  • HCV RNA
  • anti-HIV-1/2
  • HIV-1 RNA
  • anti-HTLV-I/II
  • syphilis serology
  • WNV RNA

4
Historical perspective
  • Pre-1985 syphilis, HBsAg
  • 1985-1989 better HBsAg, HIV, HTLV,
  • ALT, anti-HBc (surrogates for nonA, nonB Hep)
  • 1990 added HCV, HIV-2, HTLV-II
  • 1996 HIV p24 Ag testing
  • 1999 HIV, HCV NAT
  • 2004 WNV NAT

5
Hepatitis B
  • transmitted through parenteral, sexual
    exposure
  • mean incubation time 90 days
  • 50 of infections are symptomatic
  • 1/500 infections are lethal
  • 6 -10 of infections become chronic
  • vaccination makes donor anti-HBs, HBsAg-,
    anti-HBc-
  • risk of transmission 1/66,000

6
Hepatitis C
  • Transmitted through parenteral (common) or sexual
    (rare) exposure
  • Most common chronic blood-borne infection in US
    with 150,000 new cases/year.
  • 4 million infected in US
  • Most common transfusion-transmitted disease
  • Most common cause of liver transplants.
  • 75 of infections become chronic
  • Latency of symptomatic liver disease can be
    decades
  • Antibody appears in serum 54 192 days
    post-infection
  • Risk of transmission 1/103,000

7
HIV
  • First reports of transfusion-transmitted HIV in
    1982
  • Blood product testing began in 1985
  • transmitted through parenteral, sexual exposure
  • Variable latency period
  • Antibody titer detectable 45 days
    post-infection
  • Common symptoms include night sweats, weight
    loss, diarrhea, thrush, purpura
  • Infection chronic, but viral load abated with
    multi-drug therapy
  • Risk of transmission 1/563,000

8
Transfusion transmission risks
1100
Transmission risk, per unit
HIV
11000
HBV
110 000
HCV
1100 000
11 000 000
1998
2000
1996
1994
1992
1990
1988
1986
1984
2002
9
HTLV-I/II
  • Transmitted through parenteral or sexual exposure
  • HTLV-I endemic in Japan and the Caribbean
  • Most infections generate only mild symptoms
  • HTLV-1 causes adult T-cell leukemia/lymphoma
    (0.1/year)
  • neurological disorder similar to MS (0.1/year)
  • Risk of transmission 1/641,000.

10
West Nile Virus
  • transmitted by arthropod exposure (incidental)
  • birds are primary hosts
  • 50nm spherical, lipid-enveloped flavivirus
  • Single-stranded positive sense RNA genome (11,000
    nts)
  • Encephalitis, meningites
  • Asymmetric flaccid paralysis (poliomyelitis-like)
  • 2002 4156 cases reported in U.S. (284
    fatalities)
  • 5-10 mortality
  • Initial screening by questionnaire
  • Voluntary NAT testing through 2004, 1017 units
    withdrawn due to presumptive WNV infection
  • Peak exposure in August-September
  • Viremia 6.5 to 56.4 days

11
Syphilis
  • The great imitator
  • transmitted by sexual exposure
  • rarely transmitted by transfusion (2-3 reports in
    30 years)
  • seroconversion occurs after occurs after
    spirochetemia
  • untreated infection progresses through multiple
    stages
  • testing is required by AABB (past 50 years)
  • syphilis positivity considered surrogate marker
    for other diseases transmitted by high-risk
    behaviors
  • RPR for cardiolipin or reagin (non-specific)
  • Positive RPR sent for treponemal antibody testing
    (specific)

12
Misperception?
Syphilis is a venereal disease that can also be
acquired by exposure to infected blood. -
introduction to eMedicine article
http//www.emedicine.com/MED/topic2224.htm
13
Trends in infectious disease
14
Syphilis
15
RPR (non-treponemal)
  • Antigen
  • 0.003 cardiolipin
  • 0.02 lecithin
  • 0.09 cholesterol
  • 10 choline chloride
  • 0.01875 charcoal
  • specimen not heat-inactivated
  • acceptable specimens serum, plasma, cord blood
  • unacceptable specimen CSF

16
VDRL (non-treponemal)
  • Antigen
  • 0.03 cardiolipin
  • 0.2 lecithin
  • 0.9 cholesterol
  • specimen heat-inactivated
  • acceptable specimens serum, CSF, cord blood
  • unacceptable specimen plasma

17
FTA-ABS (treponemal)
  • Antigen
  • suspension of Treponema pallidum (Nichols)
    extracted from rabbit testicular tissue
  • Sorbent
  • cultures of nonpathogenic Reiter treponemes
  • Detection
  • FITC-labeled rabbit antihuman IgG

18
TP-PA MHA-TP (treponemal)
  • Antigen
  • formalinized tanned sheep erythrocytes sensitized
    with T. pallidum (2.5 suspension)
  • Sorbent
  • 0.5 sheep red cell membranes
  • 0.25 bovine red cell membranes
  • 0.1 rabbit testicular extract
  • 0.125 sonicated Reiter treponeme
  • 1 normal rabbit serum
  • Detection
  • Agglutination

19
Sensitivities and Specificities of Syphilis
serology tests
Standard Status Nontreponemal Tests
Standard Status Treponemal Tests
20
Causes of false positive non-treponemal tests
21
Causes of false positive treponemal tests
22
AABB position on syphilis testing
STATEMENT OF THE AMERICAN ASSOCIATION OF BLOOD
BANKS BEFORE THE BLOOD PRODUCTS ADVISORY
COMMITTEE September 15, 2000 Syphilis Testing
Presented by Louis Katz, MD Chair, AABB
Transfusion Transmitted Disease Committee
AABB believes the requirement for performing an
STS on each whole blood donation can safely be
eliminated based on thirty years experience
23
AABB position on syphilis testing Rationale
  • transfusion-transmitted syphilis not recognized
    in US for 30 years
  • transmissibility of T. pallidum occurs before
    the STS is reactive
  • storage of blood components in refrigerators
    and improved oxygen tension likely to prevent
    transmission of spirochetes
  • from 1990 to 1997, 57 of 241,800 component
    recalls were for incorrect syphilis testing

24
Serological vs NAT testing
  • Window period (based on serological testing)
  • HCV (80d)
  • HBV (56 d)
  • HIV (16 d)
  • Window period (based on NAT)
  • HCV (10-30 d)
  • HIV (10 d)

http//www.moffitt.usf.edu/pubs/ccj/v6n5/dept5.htm
25
Algorithm for multiplex NAT screening
26
Syphilis NAT testing
  • Published PCR targets
  • tpf-1
  • BMP
  • tmpA, tmpB
  • 47-kDa protein gene
  • 16S RNA
  • polA
  • Sensitivity
  • 200 organisms/ml
  • gold-standard (RIT) detects 2 organisms/ml

27
Proposal for Treponema pallidum diagnostic PCR
based on the highly conserved mutL gene
  • Primers
  • forward CTTGAAACGCAAATGCTCAA
  • reverse CCCTCGCTTCCTAACACAAG
  • PCR product 197 bp
  • Rationale
  • bacterial mutL homologs are conserved through
    to humans and are essential for function

28
Serology vs NAT testing for Treponema pallidum
  • Window period for syphilis 1 3 wks
  • NAT testing can identify 50 organisms (decreasing
    window to less than 1 week).
  • The rabbit infectivity test (RIT), "gold
    standard" test has a detection limit of a single
    organism and can be used to confirm T. pallidum
    infection
  • requires access to an animal facility
  • extremely time-consuming and expensive
  • Minimum TAT 90 d

29
Problems with NAT testing for syphilis
  • molecular biological expertise required
  • special precautions to prevent cross-contamination
  • commercially available NAT assays require more
    than 12 hours to perform
  • the cost of each commercial NAT test is
    approximately 10 times that of the most expensive
    EIA test.

30
Conclusion serological testing for syphilis in
blood products
  • Serological testing for syphilis in individual
    donated blood products should be eliminated or
    replaced with highly specific and sensitive NAT
    testing, to be performed in multiplex algorithm
    with other NAT screens

31
Bibliography
  • Orton, S.L., Liu, H., Dodd, R.Y., Williams, A.E.
    (2002) Prevalence of circulating Treponema
    pallidum DNA and RNA in blood donors with
    confirmed-positive syphilis tests. Transfusion.
    42 94-99
  • Palmer, H.M., Higgins, S.P., Herring, A.J.,
    Kingston, M.A. (2003) Use of PCR in the diagnosis
    of early syphilis in the United Kingdom. Sex.
    Transm. Infect. 79 479-483.
  • Liu, H., Rodes, B., Chen, C.-Y., Steiner, B.
    (2001) New tests for syphilis rational design of
    a PCR method for detection of Treponema pallidum
    in clinical specimens using unique regions of the
    DNA polymerase I gene. J. Clin. Microbiol.
    391941-1946
  • Harmening, D.M. (2005) Modern Blood Banking and
    Transfusion Practices, 5th ed. Philadelphia F.A.
    Davis and Co.
  • Brecher, M.E., ed. (2002) AABB Technical Manual,
    14th ed. Bethesda, MD American Association of
    Blood Banks.
  • http//www.aabb.org/pressroom/press_releases/prbpa
    csyph091400.htm
  • http//www.moffitt.usf.edu/pubs/ccj/v6n5/dept5.htm
  • http//www.aabb.org/About_the_AABB/Stds_and_Accred
    /stdsproposedbbts24.pdf
  • http//www.emedicine.com/MED/topic2224.htm
  • http//www.bloodbook.com/trans-tran.html
  • http//www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd
    RetrievedbNucleotidelist_uids3322571doptGenB
    ank
About PowerShow.com