Biotechnology - PowerPoint PPT Presentation

Loading...

PPT – Biotechnology PowerPoint presentation | free to view - id: 2c6e2-MGNjO



Loading


The Adobe Flash plugin is needed to view this content

Get the plugin now

View by Category
About This Presentation
Title:

Biotechnology

Description:

Biotechnology. bios = life technos = tool ... Murder case in Phoenix, Arizona ... XVIII (child king who died in prison) compared to hair from Marie Antoinette ... – PowerPoint PPT presentation

Number of Views:277
Avg rating:3.0/5.0
Slides: 60
Provided by: bartel
Category:

less

Write a Comment
User Comments (0)
Transcript and Presenter's Notes

Title: Biotechnology


1
Biotechnology
  • bios life technos tool logos study of
  • Biotechnology The Study of Living Tools

2
1. Timeline
  • 4000 BC Egyptians use yeasts for bread and wine
  • 1750 BC Sumerians brew beer
  • 1500 AD Aztecs make cakes from Spirulina algae
  • 1917 Biotechnology term coined
  • 1972 Hamilton Smith discovers first restriction
    enzyme
  • 1973 Stanley Cohen made first transgenic organism
    with gene from African clawed toad into
    bacteria
  • 1978 Louise Brown, first test tube baby born
  • 1981 PCR Invented by Kary Mullis
  • Genentech releases (Humulin?) human insulin
  • 1984 PCR used by Alec Jeffries in DNA
    fingerprinting
  • EPA approves release of genetically engineered
    tobacco
  • 1990 Pfizer introduces Chymosin (Rennin)
  • Michael Crichtons Jurassic Park published
  • 1993 FDA approval of Monsantos rBGH/rBST
  • 1994 Calgene introduces Flavr-Savr? Tomato
  • 1995 O.J. Simpson Trial
  • 1996 Sequence completed for S. cervisiae
  • 1997 Cloning of Dolly at Roslin Institute
  • 1998 First animal genome sequenced C. elegans

3
Selective Breeding
  • a. Luther Burbank
  • disease resistant Burbank potato
  • fight blight, etc in Ireland
  • b. Norman Borlaug of International Maize
  • Wheat Research Center in Mexico
  • (received Nobel Prize)
  • Crossed short-stemmed wheat with
  • Mexicos best wheat
  • Govt of India requested seeds,
  • as tall wheat plants falling over
  • Increased wheat production from 12 million metric
    tons in 1965, to 20 million in 1970, 37 million
    in 1982
  • c. Hybridization
  • Dissimilar individuals mate to hope to get
    desired traits
  • Burbank Popular Shasta Daisies
  • d. Inbreeding
  • Keep desired traits
  • Brings recessive traits too (joints in golden
    retrievers)

4
Increasing Variation
  • a. Inducing mutations in bacteria
  • Radiation, chemicals, r-strategists
  • Can clean up oil spills (bioremediation)
  • b. Polyploidy (extra chromosomes)
  • Usually fatal in animals
  • Bigger, stronger, sexier plants (bananas, citrus
    fruits, day lilies)

5
DNA Manipulation
  • 1. Cutting Separating
  • a. Restriction Enzymes
  • Proteins from bacteria that cut DNA at specific
    points
  • Cut at palindromes
  • Evolved as viral defenses
  • Can have blunt or sticky ends
  • Can be spliced into DNA cut with same RE

Naming of EcoR1 E from genus of organism where
found (Escheria) co first 2 letters of species
name (coli) R Strain (RY13) 1 Order discovered
6
Restriction Enzymes
7
(Cutting Separating, Contd)
  • b. Gel Electrophoresis
  • Migration of charged particles under electric
    field
  • DNA has negatively charged phosphate ends
  • (-) electrode repels DNA, () electrode attracts
    DNA
  • 1 agarose gel (natural colloid from seaweed)
  • agarose is convoluted like a sieve
  • TBE solution is electrolytic solution
  • Migration of DNA molecules move through gel at
    different rates (bigger slower, smaller
    faster)
  • DNA is stained to see bands (Ethidium Bromide)
  • Usually a marker is used (of known fragment sizes)

8
Equipment
9
Digest Separation
10
(No Transcript)
11
(Cutting Separating, Contd)
  • c. Restriction Mapping
  • Use of various restriction enzymes
  • Gel digests show size of fragments
  • Patterns of digests can create restriction map
  • pUK 1 plasmid

Gel Digest Restriction Map
12
  • Restriction digest of plasmid DNA from
    Escherichia coli
  • run on a 1 agarose gel and stained with ethidium
    bromide
  • Lane 1 (far left) is a kilobase DNA ladder
  • Lane 2 is the uncut plasmid DNA
  • Lane 3 is a single digestion of the plasmid with
    the EcoRI
  • Lane 4 is also a single digestion, but with XhoI
  • Lane 5 (far right) is a double digestion - both
    EcoRI and XhoI

13
(No Transcript)
14
DNA Manipulation, Contd
  • 2. Identifying Genes - Southern Blot (named after
    Ed Southern)
  • a. DNA cut with REs
  • b. Separated by Gel Electrophoresis
  • c. DNA blotted to filter paper and probe is
    added
  • d. Only DNA fragments with identified gene bind
    to probe

15
Southern Blot
16
DNA Manipulation, Contd
  • 3. Nucleotide Sequencing (fluorescent
    dye-terminator cycle sequencing)
  • a. Unknown Single Stranded DNA put in test tube
  • b. DNA polymerase and nucleotide bases (dNTPs)
    added
  • c. Small number of bases with flourescent dye
    attached (ddNTPs)
  • d. Each time dye-labeled nucleotide binds to
    fragment, synthesis stops
  • e. Ultimately yields DNA strands of different
    lengths
  • f. Separated (by gel electrophoresis)
  • g. Color of bands tells sequence (read by laser
    detector, computer software analyzes)

17
(No Transcript)
18
(No Transcript)
19
Laser Readout
20
ABI Prism
21
DNA Manipulation, Contd
  • 4. Making Copies (Polymerase Chain Reaction or
    PCR)
  • a. Small amount of double stranded DNA
  • b. Heated to separate, then cooled
  • c. Add DNA polymerase, primers (short pieces of
    artificial DNA), and free nucleotides
  • Taq polymerase (from Thermophilus aquaticus)
  • Isolated from hot springs in Yellowstone
  • Can withstand hot temperatures
  • d. DNA poly attaches nucleotides to primers
  • e. REPEATED many times (5 minute cycles)
  • f. Use of a thermal cycler

22
(No Transcript)
23
(No Transcript)
24
DNA Manipulation, Contd
  • 5. Recombinant DNA
  • a. Use REs to cut out gene
  • b. Cut host DNA with same RE
  • c. Need a vector to incorporate into host
  • d. Screen for effective transfer
  • e. If successful, then results in Transgenic
    Organism
  • f. First done by Steven Howell by inserting
    luciferase gene (for glowing) from firefly into
    tobacco plant
  • g. Transgenic Organisms
  • 1. Bacteria
  • Transformation with plasmid
  • Plasmid ring of DNA used to transfer genes

25
(No Transcript)
26
(No Transcript)
27
  • 2. Plants
  • Bacterium
  • Has small DNA plasmid causes tumors
  • Inactivation of tumor gene
  • Insertion of foreign DNA
  • May uptake DNA if cell walls removed
  • Gene gun!
  • 3. Animals
  • Viral vectors

28
  • 4. Nuclear Transfer
  • Can inject DNA into large egg nuclei
  • Enzymes used to repair and recombine DNA in cell
    help insert foreign DNA

29
  • 5. Scientists may also insert marker gene to tell
    if procedure worked
  • ampicillin resistance (bacteria then grown on
    nutrient medium with ampicillin)
  • glowing gene from jellyfish (produces GFP)

To determine what turns on color in wings,
University of Buffalo (NY) biologists inserted a
marker gene from jellyfish into African
butterflies resulting in fluorescent green eyes
30
Using Glowing Markers
Fruit Fly Embryo
Glowing Tobacco!!
31
  • 6. Knockout Mice
  • Scientists transfer a defective version of a gene
    they want to study into stem cells
  • The defective gene knocks out the normal gene,
    and scientists can examine the effects of the
    disabled gene on the resulting young mouse.
  • Using gene targeting, researchers can transfer
    human disease genes into embryonic stem cells to
    make mouse models of many human ailments

32
(No Transcript)
33
(No Transcript)
34
  • 7. Whole Genome Analysis
  • Allows analysis of multiple genes in various
    conditions
  • Complexity does not come from the number of
    genes, but from the way in which they are used
    (Gerald Rubin, HHMI VP)
  • Gene Chips (Affymetrix)
  • ½ square inch glass with short DNA fragments
  • 200,000 each
  • Microarrayer
  • Robot designed by Patrick Brown _at_ Stanford
  • Can analyze 6,000 genes in yeast simultaneously
  • Make your own for 25,000

35
(No Transcript)
36
A Microarrayer Shows How Genes in a Yeast Cell
Respond to Different Types of Stress
http//www.hhmi.org/genesweshare/a110.html
37
(No Transcript)
38
US GOV vs. Celera Genomics
39
Uses
  • 1. Human Genome Project
  • a. Attempt to map all of human genome!
  • b. Begun in 1999, working draft Feb. 2001,
    finished 2003 (3 years ahead of schedule!)
  • c. Collaboration of 20 labs in 6 countries
  • d. Competition with Craig Ventnor, Celera
    Genomics
  • e. Discoveries
  • 3.2 billion base pairs
  • only 30-40,000 genes
  • over 120,000 unique mRNA molecules
  • only 1-1.5 of human DNA codes for proteins
  • Each cell has 6 ft of DNA 1 inch of exons to be
    transcribed
  • Most of genome is Junk DNA
  • Genes not evenly distributed
  • Chromosome 19 packed with genes
  • Large chromosomes 4 8 have few transcribed genes

40
Types of Genetic Maps
41
pGLO Plasmid Map
42
  • pGLO Sequence
  • ATCGATGCATAATGTGCCTGTCAAATGGACGAAGCAGGGATTCTGCAAA
    CCCTATGCTACTCCGTCAAGCCGTCAATTGTCTGATTCGTTACCAATTAT
    GACAACTTGACGGCTACATCATTCACTTTTTCTTCACAACCGGCACGGAA
    CTCGCTCGGGCTGGCCCCGGTGCATTTTTTAAATACCCGCGAGAAATAGA
    GTTGATCGTCAAAACCAACATTGCGACCGACGGTGGCGATAGGCATCCGG
    GTGGTGCTCAAAAGCAGCTTCGCCTGGCTGATACGTTGGTCCTCGCGCCA
    GCTTAAGACGCTAATCCCTAACTGCTGGCGGAAAAGATGTGACAGACGCG
    ACGGCGACAAGCAAACATGCTGTGCGACGCTGGCGATATCAAAATTGCTG
    TCTGCCAGGTGATCGCTGATGTACTGACAAGCCTCGCGTACCCGATTATC
    CATCGGTGGATGGAGCGACTCGTTAATCGCTTCCATGCGCCGCAGTAACA
    ATTGCTCAAGCAGATTTATCGCCAGCAGCTCCGAATAGCGCCCTTCCCCT
    TGCCCGGCGTTAATGATTTGCCCAAACAGGTCGCTGAAATGCGGCTGGTG
    CGCTTCATCCGGGCGAAAGAACCCCGTATTGGCAAATATTGACGGCCAGT
    TAAGCCATTCATGCCAGTAGGCGCGCGGACGAAAGTAAACCCACTGGTGA
    TACCATTCGCGAGCCTCCGGATGACGACCGTAGTGATGAATCTCTCCTGG
    CGGGAACAGCAAAATATCACCCGGTCGGCAAACAAATTCTCGTCCCTGAT
    TTTTCACCACCCCCTGACCGCGAATGGTGAGATTGAGAATATAACCTTTC
    ATTCCCAGCGGTCGGTCGATAAAAAAATCGAGATAACCGTTGGCCTCAAT
    CGGCGTTAAACCCGCCACCAGATGGGCATTAAACGAGTATCCCGGCAGCA
    GGGGATCATTTTGCGCTTCAGCCATACTTTTCATACTCCCGCCATTCAGA
    GAAGAAACCAATTGTCCATATTGCATCAGACATTGCCGTCACTGCGTCTT
    TTACTGGCTCTTCTCGCTAACCAAACCGGTAACCCCGCTTATTAAAAGCA
    TTCTGTAACAAAGCGGGACCAAAGCCATGACAAAAACGCGTAACAAAAGT
    GTCTATAATCACGGCAGAAAAGTCCACATTGATTATTTGCACGGCGTCAC
    ACTTTGCTATGCCATAGCATTTTTATCCATAAGATTAGCGGATCCTACCT
    GACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATACCCGTTTTTTTGG
    GCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGGCTAG
    CAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAG
    ATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGT
    GATGCTACATACGGAAAGCTTACCCTTAAATTTATTTGCACTACTGGAAA
    ACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCTCTTATGGTGTTC
    AATGCTTTTCCCGTTATCCGGATCATATGAAACGGCATGACTTTTTCAAG
    AGTGCCATGCCCGAAGGTTATGTACAGGAACGCACTATATCTTTCAAAGA
    TGACGGGAACTACAAGACGCGTGCTGAAGTCAAGTTTGAAGGTGATACCC
    TTGTTAATCGTATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAAC
    ATTCTCGGACACAAACTCGAGTACAACTATAACTCACACAATGTATACAT
    CACGGCAGACAAACAAAAGAATGGAATCAAAGCTAACTTCAAAATTCGCC
    ACAACATTGAAGATGGATCCGTTCAACTAGCAGACCATTATCAACAAAAT
    ACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTC
    GACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGCGTGACCACATGG
    TCCTTCTTGAGTTTGTAACTGCTGCTGGGATTACACATGGCATGGATGAG
    CTCTACAAATAATGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCG
    ACCTGCAGGCATGCAAGCTTGGCTGTTTTGGCGGATGAGAGAAGATTTTC
    AGCCTGATACAGATTAAATCAGAACGCAGAAGCGGTCTGATAAAACAGAA
    TTTGCCTGGCGGCAGTAGCGCGGTGGTCCCACCTGACCCCATGCCGAACT
    CAGAAGTGAAACGCCGTAGCGCCGATGGTAGTGTGGGGTCCCCCATGCGA
    GAGTAGGGAACTGCCAGGCATCAAATAAAACGAAAGGCTCAGTGCAAAGA
    CTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTA
    GGACAAATCCGCCGGGAGCGGATTTGAACGTTGCGAAGCAACGGCCCGGA
    GGGTGGCGGGCAGGACGCCCGCCATAAACTGCCAGGCATCAAATTAAGCA
    GAAGGCCATCCTGACGGATGGCCTTTTTGCGTTTCTACAAACTCTTTGTT
    TATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCC
    TGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACA
    TTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTT
    TTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTG
    GGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCT
    TGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAG
    TTCTGCTATGTGGCGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAA
    CTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACC
    AGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCA
    GTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACA
    ACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGA
    TCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATAC
    CAAACGACGAGCGTGACACCACGATGCCTGCAGCAATGGCAACAACGTTG
    CGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATT
    AATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGG
    CCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGT
    GGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCG
    TATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAA
    ATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTG
    TCAGACCAAGTTTACTCATATATACTTTAGATTGATTTACGCGCCCTGTA
    GCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCT
    ACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTT
    TCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCC
    CTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTT
    GATTTGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTT
    TCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCC
    AAACTGGAACAACACTCAACCCTATCTCGGGCTATTCTTTTGATTTATAA
    GGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACA
    AAAATTTAACGCGAATTTTAACAAAATATTAACGTTTACAATTTAAAAGG
    ATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACG
    TGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGAT
    CTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAA
    AAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAAC
    TCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTG
    TCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCA
    CCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAG
    TGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGG
    ATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGC
    TTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCATTG
    AGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAA
    GCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAAC
    GCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCG
    TCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCA
    GCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCAC
    ATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGC
    CTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCG
    AGTCAGTGAGCGAGGAAGCGGAAGAGCGCCTGATGCGGTATTTTCTCCTT
    ACGCATCTGTGCGGTATTTCACACCGCATATGGTGCACTCTCAGTACAAT
    CTGCTCTGATGCCGCATAGTTAAGCCAGTATACACTCCGCTATCGCTACG
    TGACTGGGTCATGGCTGCGCCCCGACACCCGCCAACACCCGCTGACGCGC
    CCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACC
    GTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACG
    CGCGAGGCAGCAAGGAGATGGCGCCCAACAGTCCCCCGGCCACGGGGCCT
    GCCACCATACCCACGCCGAAACAAGCGCTCATGAGCCCGAAGTGGCGAGC
    CCGATCTTCCCCATCGGTGATGTCGGCGATATAGGCGCCAGCAACCGCAC
    CTGTGGCGCCGGTGATGCCGGCCACGATGCGTCCGGCGTAGAGGATCTAA
    TTCTCATGTTTGACAGCTTATC

43
(No Transcript)
44
(No Transcript)
45
  • 2. DNA Fingerprinting
  • a. History
  • Lynda Mann in England
  • Raped and Murdered, Nov. 22, 1983
  • Local dishwasher questioned pleads guilty to
    similar case
  • Alec Jeffries uses new method of PCR for
    identification, exonerates dishwasher of both
    crimes
  • Every man in area fingerprinted by DNA, no
    matches
  • Colin Pitchfork finally caught and tested
    positive (friend went in to fake test for him)
  • Plant Witness
  • Murder case in Phoenix, Arizona
  • Pager found at crime scene led police to suspect
    (said that victim had robbed him)
  • Palo Verde pods in truck yielded DNA that matched
    with trees at crime scene

46
  • b. Uses
  • Identification and exoneration of rapists,
    criminals
  • Paternity cases (Jefferson/Sally Hemmings)
  • Identification of body parts
  • Supposed heart of Louis XVIII (child king who
    died in prison) compared to hair from Marie
    Antoinette
  • ID of bodies in mass graves in Guatemala (from
    civil war)
  • Genetic testing (blood stain on Lincolns jacket
    tested for Marfans syndrome)
  • Migration patterns
  • ID tags for children, pets
  • ID of endangered/protected species
  • Food authentication, such as in wine and caviar
  • Authentication of official 2000 Summer Olympic
    goods (sections of DNA taken from several unnamed
    Australian athletes added to ink used to mark all
    items)

47
National Geographic March 2006
48
  • c. Use of RFLPs (restriction fragment length
    polymorphisms)
  • Procedure
  • Restriction enzymes cut DNA differently
  • Fragments separated with GE
  • Probed and exposed to X-ray film
  • Screening for Sickle Cell Anemia
  • Point mutation of CAG (betaA gene) to CTG (betaS
    gene) SNP or single nucleotide polymorphism
  • Produces valine instead of glutamic acid in
    hemoglobin molecule
  • REs cut DNA differently
  • Probe attaches to specific sequence
  • Affected large fragment
  • Pedigree shows family son with sickle-cell
    anemia
  • Electrophoresis pattern below each child

49
RFLP
50
  • d. DNA Typing
  • Small percentage of DNA different from person to
    person (less than 1/10th of 1)
  • Variable regions used for comparison

Gel Lanes MARKERS VICTIM EVIDENCE 1 (semen stain
left on the victim's clothing) EVIDENCE 2
(semen from the vagina of the rape victim)
SUSPECT 1 SUSPECT 2 CONTROL (check to see if
probes are working)
  • Results
  • Suspect 2 can be clearly ruled out
  • Suspect 1 MAY be guilty (probability that 6
    alleles match is 1 in 4056)
  • Suspects NOT picked at random Evidence used in
    conjunction with
  • More probes (alleles) the better 14 chance of
    match is 1 in 268 million

51
  • 3. Transgenic Organisms
  • a. Medicine
  • 1. Isolate gene for protein needed for medicine
  • 2. Inserted into bacteria, will make protein in
    normal course of its life cultured in bioreactor

Humulin? (Human Insulin)
52
Genetically Engineered Medicines
  • Erythropoetin Anemia
  • Growth Factors Burns, Ulcers
  • Human Growth
  • Hormone (HGH) Dwarfism
  • Insulin Diabetes
  • Interferons Viral Infections, Cancer
  • Taxol Ovarian Cancer

53
(No Transcript)
54
  • 3. Inserted into animals (livestock)
  • Dolly cloned in 1997 by Ian Wilmut in Scotland
  • Potential to produce protein in milk
  • Cloning done once, then livestock reproduce
    regularly to pass on gene FARMacy

55
  • b. Agriculture
  • 1. Improving crops
  • Crops resistant to biodegradable weedkiller
    (glyphosate)
  • Kills only weeds
  • Half of 72 million acres of Soybeans in 2000
  • Flavr-Savr? tomato last longer
  • Genetically enhanced rice with more Vitamin A

56
  • Concerns
  • Natural resistance to enhancement
  • Jumping genes
  • Allergies
  • 2. Improving livestock growth hormone added to
    cow (bGH/bST)
  • c. Bioremediation - microorganisms engineered to
    feed on toxic or hazardous materials
  • 1. Pseudomonas bacteria engineered to degrade
    polyhalogentated compounds (pollutants)
  • 2. E. coli engineered to clean up mercury

57
Bioremediation Cartoon
58
4. RNA interference (RNAi)
  • post-transcriptional gene silencing
  • double stranded RNA (dsRNA) causes
    sequence-specific degradation of homogolous
    mRNAsequences
  • First found in C. elegans

59
The Future?
  • Alternatives to antibiotics to protect livestock
    against bacterial infections
  • 2nd Gen of GM crops is expected that could
    eliminate of allergens in food, increase
    nutritional content, and lower fat and oil levels
  • 3rd Gen GM crops may have properties like salt
    tolerance, drought resistance, drugs and vaccines
    within them, and plastic starter chemicals to
    create bioplastics
  • http//www.biotechnologyonline.gov.au/foodag/timel
    ine.cfm
About PowerShow.com