Presentacin de PowerPoint - PowerPoint PPT Presentation

Loading...

PPT – Presentacin de PowerPoint PowerPoint presentation | free to view - id: 27bf51-MjEzO



Loading


The Adobe Flash plugin is needed to view this content

Get the plugin now

View by Category
About This Presentation
Title:

Presentacin de PowerPoint

Description:

Presentacin de PowerPoint – PowerPoint PPT presentation

Number of Views:89
Avg rating:3.0/5.0
Slides: 55
Provided by: eloisaar
Category:

less

Write a Comment
User Comments (0)
Transcript and Presenter's Notes

Title: Presentacin de PowerPoint


1
Evolución, Filogenia y Clasificación de los Seres
Vivos
Biol. Luis José Delaye Arredondo
Laboratorio de Microbiología Facultad de
Ciencias UNAM
2
CHARLES ROBERT DARWINFebruary 12, 1809 to April
19, 1882 The Evolution of a Global Celebration
http//www.darwinday.org/dispevent/index.php
3
(No Transcript)
4
Las cinco principales teorías de Darwin
Evolución como tal Gradualismo Especiacion
poblacional Selección natural Origen común
Ernst Mayr (1905 - 2005)
5
Evolución como tal
6
Gradualismo
7
Especiación Poblacional
8
Selección Natural
9
El Argumento de la Selección Natural
Hecho 1 Crecimiento exponencial potencial de las
poblaciones (superfecundidad) (Fuente Paley,
Malthus y otros)
Inferencia 1 Lucha por la existencia entre los
indiviudos (Autor de la inferencia Malthus)
Hecho 2 Estabilidad de estado estacionario
observada en las poblaciones (Fuente
observaciones universales)
Inferencia 2 Supervivencia diferencial, es decir,
selección natural (Autor de la inferencia Darwin)
Inferencia 3 A través de muchas generaciones
evolución (Autor de la inferencia Darwin)
Hecho 4 Unicidad del individuo (Fuente criadores
de animales, taxónomos)
Hecho 3 Limitación de los recursos (Fuente
observación reforzada por Malthus)
Hecho 5 Heredabilidad de gran parte de la
variación individual (Fuente criadores de
animales)
Ernst Mayr (1991)
10
S. J. Gould (1941 - 2002)
11
S. J. Gould (1941 - 2002)
12
Scope
Efficacy
The claim that these microevolutionary modes and
processes can, by extrapolation through the
vastness of geological time, expline the full
panoply of lifes changes in form and diversity
The claim that selection acts as the primary
creative force in building evolutionary novelties
Agency
The claim for organismal selection as the causal
locus of the basic mechanism
Natural selection
13
Ancestría común
14
(No Transcript)
15
All living things have much in common, in their
chemical composition, their germinal vesicles,
their cellular structure, and their laws of
growth and reproduction. Therefore I should
infer that probably all the organic beings
which have ever lived on this earth have
descended from some one primordial form, into
which life was first breathed.   On the Origin
of Species, (1859, page 484) Charles Darwin
16
Jean-Baptiste Pierre Antoine De Monet, Chavalier
De Lamarck (1744-1829)
Philosophie Zoologique (1809)
17
(No Transcript)
18
?
19
(No Transcript)
20
(Haekel, 1860)
21
Planeta de los microorganimsos
22
Prokaryonte
Eukaryonte
(Chatton, 1932)
23
(Wittaker, 1960)
24
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAA
AAAGAGTGTCTGATAGCAGCTTCTGAACTGGTTACCTGCCGTGAGTAAAT
TAAAATTTTATTGACTTAGGTCACTAAATACTTTAACCAATATAGGCATA
GCGCACAGACAGATAAAAATTACAGAGTACACAACATCCATGAAACGCAT
TAGCACCACCATTACCACCACCATCACCATTACCACAGGTAACGGTGCGG
GCTGACGCGTACAGGAAACACAGAAAAAAGCCCGCACCTGACAGTGCGGG
CTTTTTTTTTCGACCAAAGGTAACGAGGTAACAACCATGCGAGTGTTGAA
GTTCGGCGGTACATCAGTGGCAAATGCAGAACGTTTTCTGCGTGTTGCCG
ATATTCTGGAAAGCAATGCCAGGCAGGGGCAGGTGGCCACCGTCCTCTCT
GCCCCCGCCAAAATCACCAACCACCTGGTGGCGATGATTGAAAAAACCAT
TAGCGGCCAGGATGCTTTACCCAATATCAGCGATGCCGAACGTATTTTTG
CCGAACTTTTGACGGGACTCGCCGCCGCCCAGCCGGGGTTCCCGCTGGCG
CAATTGAAAACTTTCGTCGATCAGGAATTTGCCCAAATAAAACATGTCCT
GCATGGCATTAGTTTGTTGGGGCAGTGCCCGGATAGCATCAACGCTGCGC
TGATTTGCCGTGGCGAGAAAATGTCGATCGCCATTATGGCCGGCGTATTA
GAAGCGCGCGGTCACAACGTTACTGTTATCGATCCGGTCGAAAAACTGCT
GGCAGTGGGGCATTACCTCGAATCTACCGTCGATATTGCTGAGTCCACCC
GCCGTATTGCGGCAAGCCGCATTCCGGCTGATCACATGGTGCTGATGGCA
GGTTTCACCGCCGGTAATGAAAAAGGCGAACTGGTGGTGCTTGGACGCAA
CGGTTCCGACTACTCTGCTGCGGTGCTGGCTGCCTGTTTACGCGCCGATT
GTTGCGAGATTTGGACGGACGTTGACGGGGTCTATACCTGCGACCCGCGT
CAGGTGCCCGATGCGAGGTTGTTGAAGTCGATGTCCTACCAGGAAGCGAT
GGAGCTTTCCTACTTCGGCGCTAAAGTTCTTCACCCCCGCACCATTACCC
CCATCGCCCAGTTCCAGATCCCTTGCCTGATTAAAAATACCGGAAATCCT
CAAGCACCAGGTACGCTCATTGGTGCCAGCCGTGATGAAGACGAATTACC
GGTCAAGGGCATTTCCAATCTGAATAACATGGCAATGTTCAGCGTTTCTG
GTCCGGGGATGAAAGGGATGGTCGGCATGGCGGCGCGCGTCTTTGCAGCG
ATGTCACGCGCCCGTATTTCCGTGGTGCTGATTACGCAATCATCTTCCGA
ATACAGCATCAGTTTCTGCGTTCCACAAAGCGACTGTGTGCGAGCTGAAC
GGGCAATGCAGGAAGAGTTCTACCTGGAACTGAAAGAAGGCTTACTGGAG
CCGCTGGCAGTGACGGAACGGCTGGCCATTATCTCGGTGGTAGGTGATGG
TATGCGCACCTTGCGTGGGATCTCGGCGAAATTCTTTGCCGCACTGGCCC
GCGCCAATATCAACATTGTCGCCATTGCTCAGGGATCTTCTGAACGCTCA
ATCTCTGTCGTGGTAAATAACGATGATGCGACCACTGGCG
25
Biología comparada
26
(No Transcript)
27
(No Transcript)
28
(No Transcript)
29
(No Transcript)
30
(Woese, 1977)
31
(Edgell and Doolittle, 1997)
32
Lynn Margulis
33
(Margulis, 70s)
34
(No Transcript)
35
(Doolittle, 1999)
36
(No Transcript)
37
(Doolittle, 1999)
38
?
39
Proceso evolutivo
40
(No Transcript)
41
progenote
(Woese Fox, 1977)
42
Progenote
Entidad biológica en donde el fenotipo aun no se
encontraba diferenciado del genotipo
Woese Fox, 1977
43
Cuando el mundo dependía del RNA
Genotipo
Fenotipo
(Woese, 1967 Crick, 1968 Orgel, 1968 Gilbert,
1986)
44
Modeling
?
(Modificado de Lazcano Miller, 1999)
45
(No Transcript)
46
LCA
47
Archaea
Bacteria
Aquifex aeolicus
Euryarchaea
Deinococcus radiodurans
Archaeoglobus fulgidus
Fusobacterium nucleatum
Halobacterium sp.
Escherichia coli K-12
Methanococcus jannaschii
Synechocystis sp.
Pyrococcus horikoshii
Thermoplasma acidophilum
Bacillus subtilis
Crenarchaea
Streptococcus pneumoniae
Aeropyrum pernix
Thermoanaerobacter tengcongensis
Pyrobaculum aerophilum
Sulfolobus solfataricus
Saccharomyces cerevisiae
Schizosaccharomyces pombe
Arabidopsis thaliana
Caenorhabditis elegans
Eucarya
48
Búsqueda de BLAST de un solo sentido
a)
b)
G1
G1
G8
G2
G8
G2
G3
G7
G3
G7
G4
G6
G4
G6
G5
G5
49
(No Transcript)
50
Evidencia del mundo del RNA!
?
RNA
Proteínas
DNA
Divergencia de linajes celulares
LCA
progenote
Origen y evolución temprana del código genético
Genomas de DNA
Origen de la vida
51
(No Transcript)
52
(No Transcript)
53
(No Transcript)
54
(No Transcript)
About PowerShow.com