PCR and Cloning - PowerPoint PPT Presentation

Loading...

PPT – PCR and Cloning PowerPoint presentation | free to view - id: 1ea79-MDJjY



Loading


The Adobe Flash plugin is needed to view this content

Get the plugin now

View by Category
About This Presentation
Title:

PCR and Cloning

Description:

... know the sequence of the gene you want to clone. Used to create libraries ... Cloning vectors are ... Cloning vectors lack the genes needed for cell ... – PowerPoint PPT presentation

Number of Views:1281
Avg rating:3.0/5.0
Slides: 36
Provided by: annelynngi
Category:
Tags: pcr | cloning

less

Write a Comment
User Comments (0)
Transcript and Presenter's Notes

Title: PCR and Cloning


1
PCR and Cloning
  • Biochemistry 651
  • March 11, 2009

2
Lecture objectives Compare and contrast shotgun
and directional cloning Identify the most
appropriate cloning method for a given
experiment Recognize the components of a
plasmid Differentiate between selection and
screening Understand how the polymerase chain
reaction works and how it relates to biological
processes Design PCR primers for a given
template and develop a simple cloning
strategy
3
Cloning overview
1. What are you going to clone and why?
2. Read the literature
3. Decide on your system vector, expression
system, method
  • If PCR is part of your method, design primers and
  • PCR conditions.
  • Digest your gene source (could be a PCR product)
    and
  • your vector with restriction enzymes

6. Ligate your digested gene and vector together.
7. Introduce the clone into cells (ex.
transformation)
8. Screen for your desired gene (your tool).
4
Shotgun cloning of the lux operon
  • Used when you dont know the sequence of the gene
    you want to clone
  • Used to create libraries
  • Requires a high-throughput screen or obvious
    phenotype

5
DNA Cloning Vectors
Cloning vectors are engineered from DNA
plasmids. DNA plasmids are naturally occurring
in bacteria and confer some selective advantage
(ie antibiotic resistance). Plasmids can be
transferred from one bacterial cell to another
(horizontal transmission). Cloning vectors lack
the genes needed for cell-to-cell transmission.
6
Two bacterial cells caught in the act of
plasmid-mediated conjugation.
www.yale.edu/turner/projects/ecoli.htm Dennis
Kunkel, 2002
7
DNA Cloning Vectors
ori is the origin of replication -necessary for
the plasmid to be copied
Ampr confers ampicillin resistance to the
bacteria.
Lacz gene allows you to screen colonies for an
inserted piece of DNA.
8
Restriction Enzyme Digestion
  • http//www.dnalc.org/ddnalc/resources/restriction.
    html

9
Shotgun cloning of the lux operon
Restriction enzyme digestion
Gene of interest
N
Vibrio fischeri genomic DNA
N many pieces
10
Shotgun cloning of the lux operon
Clone of interest
Ligate

N
Digested Plasmid
N many pieces
Library
11
Bacterial transformation
  • http//www.dnalc.org/ddnalc/resources/transformati
    on2.html
  • Electroporation Bacterial cells can also be
    subjected to a large electric field which makes
    the cell wall permeable so that circular DNA can
    leak in.

Transformation is very inefficient as low as 1
in every 105 cells may take up the DNA
Therefore you need a way to select cells that
have the plasmid.
12
Selection
No amp- all bacteria can grow You end up with a
lawn.
amp only bacteria transformed with an
ampr vector can grow
What are the 3 types of vectors that could be
present in your amp resistant bacterial colonies?
13
Selection
No amp- all bacteria can grow You end up with a
lawn.
amp only bacteria transformed with an
ampr vector can grow
  • What are the 3 types of vectors that could be
    present in your amp resistant bacterial colonies?
  • re-ligated vector
  • Vector an insert that is not your gene
  • Vector your gene

14
Blue/White Screen
White Colony lacz interrupted by an insert
Blue Colony intact lacz so b-galactosidase is
produced
This screen will distinguish between
re-ligated plasmid and plasmid insert. It will
not tell you if the insert is your gene.
Your vector must have a lacz gene with a multiple
cloning site in it for you to use this screen.
15
Selection vs. Screening
  • What is the difference between a selection and a
    screen?
  • Talk to your neighbor about your answer

16
Directed Cloning
  • Used when you know the sequence of the gene of
    interest
  • Often involves PCR
  • Very efficient

17
Real Example Cloning Thrombospondin-1 (TSP-1)
Family of glycoproteins involved in cell
adhesion, coagulation and angiogenesis.
Patients with a polymorphism in the gene encoding
TSP-1 are more likely to have a heart attack at
a younger age.
The polymorphism substitutes a Ser for a
conserved Asp at residue 700.
18
Real Example Cloning (TSP-1)
Dr. Cordes Hypothesis The TSP-1 variant leads
to early-onset heart attacks because the
substitution alters the structure and function
of TSP-1.
Experiment Express both wild type and variant
forms of TSP-1 and examine how the substitution
affects structure and function.
Goals 1) Learn how variant TSP-1 leads to heart
attacks to increase understanding of the process
of atherosclerosis. This may result in the
development of drugs to prevent and treat heart
disease. 2) Develop a simple screen for the TSP-1
variant.
19
Polymerase Chain Reaction (PCR)
  • PCR Animation http//www.dnalc.org/ddnalc/resource
    s/pcr.html

20
PCR vs. DNA replication
DNA strands are denatured by heat PCR only uses
one enzyme Taq DNA polymerase thermostable
enzyme that is stable above 90C and active at
72C Taq has no 3 5 exonuclease activity so
errors (mismatches) are not corrected (some
polymerases have this activity but they are
expensive) You can use PCR to introduce
mutations, deletions and restriction
sites. Sequence your PCR product
21
Designing PCR Primers
5 AGTGAATTCGAGCTCGGTACCGATCCTTAATTAAGTCTAGAGTCG
AC 3
Please work in groups of 2-3 to design forward
and reverse primers to amplify this piece of DNA.
22
Designing PCR Primers
5 AGTGATCTCGAGCTCTGTACCGATCCTAAGTTCAGTCTGAAGTCGA
C 3
CAAGTCAGACTTCAGCTG 5
5 AGTGATCTCGAGCTCTGT
3 TCACTAGAGCTCGAGACATGGCTAGGATTCAAGTCAGACTTCAGC
TG 5
23
DNA Plasmids
24
Choosing a restriction enyzme
25
Designing PCR Primers
To add restriction sites for cloning
EcorRI cut site
BamHI cut site
26
Designing PCR Primers
5 AGTGATGATCCTAAGTTCAGTCTGAAGTCGAC 3
CAAGTCAGACTTCAGCTG
CCTAGGTC 5
5 GGAATTC
AGTGATCTCGAGCTCTGT
3 TCACTAGAGCTCGAGACATGGCAGCTG 5
27
Tips for designing successful PCR Primers
  • 15-22 bases that match the DNA template
  • Avoid hairpins (ex. XGGGXXXCCCX
  • Avoid primer dimers (ex. F primer XXGACCXX
  • R primer NNCTGGNNN)
  • F and R primers should have similar Tms
    (50-60C)
  • calculate 4C for Gs and Cs, 2C for As and Ts
  • 50 GC content

A more detailed list of tips will be on the
website along with todays lecture
28
Designing PCR Primers
5 AGTGATCTCGAGCTCTGTACCGATCCTAAGTTCAGTCTGAAGTCGA
C 3
CAAGTCAGACTTCAGCTG 5
5 AGTGATCTCGAGCTCTGT
3 TCACTAGAGCTCGAGACATGGCTAGGATTCAAGTCAGACTTCAGC
TG 5
29
Do my primers follow the rules?
5 GGAATTCAGTGATCTCGAGCTCTGT
5 CTGGATCCGTCGACTTCAGACTGAAC
Length 25 bases, 18 match the DNA
Length 26 bases, 18 match the DNA
48 GC
54 GC
Tm 54C
Tm 54C
No hairpins
No hairpins
No primer dimers
30
The PCR Reaction
Eppendorf Mastercycler
In general, 30 cycles of denaturing, annealing,
and extending (1 min/kb of DNA)
31
Cloning a PCR product
PCR Product with restriction sites
Digest with EcoRI and BamHI
Sticky end
5 AATTCAGTGATCTCGATCTGAAGTCGACG
GTCACTAGAGCTAGACTTCAGCTGCCTAG 5
32
Cloning a PCR product
AATTCAGTGATCTCGATCTGAAGTCGACG
G CTTAA
GATCC G
GTCACTAGAGCTAGACTTCAGCTGCCTAG
Digested PCR product
Ligate
Digested plasmid
GAATTCAGTGATCTCGATCTGAAGTCGACGGATCC
CTTAAGTCACTAGAGCTAGACTTCAGCTGCCTAGG
Plasmid PCR product your clone
33
Vector re-ligation control
If you are cloning into a vector that does not
have a lacz gene, what could you do to estimate
how much of your vector re-ligates?
What are possible causes of vector re-ligation?
34
Shotgun vs. Directed cloning
Clone of interest
35
Lecture objectives Compare and contrast shotgun
and directional cloning Identify the most
appropriate cloning method for a given
experiment Recognize the components of a
plasmid Differentiate between selection and
screening Understand how the polymerase chain
reaction works and how it relates to biological
processes Design PCR primers for a given
template and develop a simple cloning
strategy
About PowerShow.com