File to download:
Title: Modeling Sequence Conservation - PowerPoint PPT Presentation
Description: chimp: ATCTCATTCGCGCATTCTGATCCGATCTATC. mouse: CTCTCATACGCGCCTTCTGTTCCGATGTATC ... Due to their common ancestry, the informant sequences are not independent. ... – PowerPoint PPT presentation
Download instruction:
The PPT version of this presentation was uploaded from an external web page or resource. We
cannot guarantee that the PPT file is still there nor can we verify that it is safe for you to
download. That said, if you wish to download it, just check that you are not a robot and then
click the download button.
