Basic Data Types

1
Basic Data Types

• Perl has three basic data types
• scalar
• array (list)
• associative array (hash)

2
Associative Arrays/Hashes

• List of scalar values (like array)
• Elements referred to by key, not index number
• Elements stored as a list of key-value pairs
• threeletter ('A','ALA','V','VAL','L','LEU')
  
• key value key value
  key value
• print threeletter'A' ALA
• print threeletter'L' ?
• exists checks if a specific hash key exists
• if (threeletter'E')
• print (threeletter'E') ?
• print "Exists\n" if exists arraykey
• print "Defined\n" if defined arraykey
• print "True\n" if arraykey

3
Getting all keys and values in a hash

• threeletter ('A','ALA','V','VAL','L','LEU')
• keys returns a list of all keys
• values returns a list of all values
• each returns one key-value pair each time its
  called
• (key, val) each threeletter
• Unlike array, not an ordered list (order of
  key-value pairs determined by the Perl
  interpreter)
• foreach k ( keys threeletter ) print k
• Might return, for instance, A L V,
• not A V L (need not to be sorted)
• foreach v ( values threeletter ) print v ?

4
Associative Arrays

• Some common functions
• keys(hash) returns a list of all the keys
• values(hash) returns a list of all the values
• each(hash) each time this is called, it will
  return a 2 element list
  consisting of the next
  key/value pair in the array
• delete(hashkey) remove the pair associated
  with key

5
More on Perl

• Subroutines and Functions
• A way to organize a program
• Wrap up a block of code
• Have a name
• Provide a way to pass values to the block and
  report back the results
• Regular expression

6
Basics about Subroutines

• define a subroutine
• sub myblock
• my (arg1, arg2, arg3, , argN) _at__
• _at__ is special variable containing args
• print "Please enter something "
• function call
• myblock(arg1, arg2, , argN)
• Example
• sub add8A
• my (rna) _at__
• rna . "AAAAAAAA"
• return rna

the original rna rna "CGAAUCUAGGAU" longer_r
na add8A(rna) print "I added 8 As to rna to
get longer_rna.\n"
7
More example

• sub denaturizing
• my (_at_products) _at__
• my _at_strands ()
• foreach pairs (_at_products)
• (A,B) split /\s/, pairs
• _at_strands (_at_strands, A, B)
• return _at_strands
• templates are stored as a string in the form "A
  B".
• Ex. ACGT TGCA
• _at_Denatured denaturizing(_at_PCRproducts)

8
Variables Scope

• A variable a is used both in the subroutine and
  in the main part program of the program.
• a 0
• print "a\n"
• sub changeA
• a 1
• print "a\n"
• changeA()
• print "a\n"
• The value of a is printed three times. Can you
  guess what values are printed?
• a is a global variable

use strict my a 0 print "a\n" sub
changeA my a 1 print "a\n"
changeA() print "a\n"
9
Ex What would be the output?

• !/usr/bin/perl -w
• dna 'AAAAA'
• result A_to_T(dna)
• print "I changed all the A's in dna to T's and
  got result\n\n"
• Subroutines
• sub A_to_T
• my(input) _at__
• dna input
• dna s/A/T/g
• return dna

Output?
I changed all the A's in TTTTT to T's and got
TTTTT
10
Regular Expressions

• Regular Expressions Language for specifying text
  strings
• Regular Expressions is a mechanism for specifying
  character patterns
• Useful for
• Finding files by name
• Finding text in a file
• Finding (or not finding) interesting text in a
  string
• Text based search and replace
• Finding and extracting text

11
Pattern Finding

• Problem find an ORF in nucleotide sequence
• Look for start (ATG) and stop codons (TAA, TAG,
  TGA)
• Pattern search operator
• m// or //
• string /ltpatterngt/ returns true if the
  pattern matches somewhere in string, false
  otherwise
• Example
• dna "GATGCCATGACACTGTTCA"
• if (dna /ATG/
• (dna /TAA/ dna /TAG/ dna
  /TGA/))
• print ORF is there"
• else
• print "no ORF!\n"

What is an ORF?
Do we see any problem?
12
Regular Expressions

• Optional characters ? , and
• /colou?r/ ? color or colour
• ? (0 or 1)
• /ooh!/ ? oh! or ooh! or ooooh!
• (0 or more)
• /oh!/ ? oh! or ooh! or ooooh!
• (1 or more)
• Wild cards .
• /beg.n/ ? begin or began or begun

13
Common Regular Expressions

• White-space characters \t (tab), \n (newline), \r
  (return)
• \s match a whitespace character
• x character 'x'
• . any character except newline
• r match at beginning of line
• r match at end of line
• rs match either or
• (r) group characters (to be saved in 1, 2,
  etc)
• xyz character class, in this case, matches
  either an 'x', a 'y', or a 'z'
• abj-oZ character class with a range in it
  matches 'a', 'b', any letter from 'j' through
  'o', or 'Z'
• r zero or more r's, where r is any regular
  expression
• r one or more r's
• r? zero or one r's (i.e., an optional r)
• name expansion of the "name" definition
• rs RE r followed by RE s (e.g., concatenation)

14
Exercise

• Ex1
• dna AGGCTCGTACGACG
• if( dna /CTCGTACG/ )
• print "I found the motif!!\n" ?
• What is the motif?
• Ex2 Find an ORF in nucleotide sequence (look for
  start (ATG) and stop codons (TAA, TAG, TGA))
• dna "tatggagcctcctgaggctacagccacacctgagccactct
  aaga"
• ?

15
Exercise

• Ex2 Find an ORF in nucleotide sequence (look for
  start (ATG) and stop codons (TAA, TAG, TGA))
• dna "tatggagcctcctgaggctacagccacacctgagccactctc
  aga"
• if (dna m/(atg(...)((tag)(taa)(tga)))/)
• print 1, "\n"
• else
• print "does not exit!\n"