DNA Technology - PowerPoint PPT Presentation

Loading...

PPT – DNA Technology PowerPoint presentation | free to download - id: 8098b7-YmVjY



Loading


The Adobe Flash plugin is needed to view this content

Get the plugin now

View by Category
About This Presentation
Title:

DNA Technology

Description:

Using restriction enzymes the ... DETECTION OF A RELATIVE SIMILARITIES ... Read Pros and Cons of Cloning Honors Bio: Read The Real Face of Cloning ... – PowerPoint PPT presentation

Number of Views:117
Avg rating:3.0/5.0
Slides: 69
Provided by: tla79
Learn more at: http://www.monroe.k12.nj.us
Category:

less

Write a Comment
User Comments (0)
Transcript and Presenter's Notes

Title: DNA Technology


1
DNA Technology
  • Chapter 13
  • Lab Biology
  • Chapter 13
  • Honors Biology

2
DNA Technology
  • DNA Technology science involved in the ability
    to manipulate genes/DNA
  • Purpose
  • Cure disease (Cystic Fibrosis)
  • Treat genetic disorders (Hemophilia, diabetes)
  • Improve food crops (better tasting, longer shelf
    life, fungus resistance)
  • Improve human life in general
  • Helps us ID genes for traits

3
I. How could you get a desired trait without
directly manipulating the organisms DNA?
  • A. Selective Breeding
  • - choosing organisms with desired traits to
    produce the next generation
  • Breeding the winners of a horse race (Smarty
    Jones)
  • Taking the seeds from the Great Pumpkin

4
B. Hybridization
  • Crossing organisms with different traits to
    produce a hardier product
  • Ex. A mule is a cross of a horse and a donkey
    Sturdy and surefooted
  • Hybrid corn tastes good and is more resistant
    to disease.

5
C. Inbreeding
  • Maintaining the present genes by breeding only
    within the population
  • Ex. Pedigree animals
  • Risk with dipping into the same gene pool and
    recessive traits showing up that may be lethal or
    harmful.

6
D. Inducing mutations
  • By using known mutagens, attempt to force
    mutations to occur
  • Radiation Chemicals
  • Not a sure bet nor do you know what you are going
    to get
  • Polyploidy (3N or 4N) plants have resulted from
    this larger hardier

7
  • II. Manipulating Genes by Altering an Organisms
    DNA
  • DNA Technology Purpose
  • Cure Diseases
  • Treat Genetic Disorder
  • Improve Food Crop
  • Improve Human Life (reproduce desired traits)

8
  • III. Practical Uses of DNA Technology (positive)
  • Pharmacutical Products
  • Genetically Engineered Vaccine
  • Increasing Agricultural Yields
  • (negative)
  • Allergies
  • GMO (genetically Modified Organisms)
  • Supperweeds

9
  • Cloning
  • Growing a population of genetically identical
    cells from a single cell
  • Lets discuss the positives and negatives of m
    cloning..
  • Lets do a little research first
  • Lab Bio Read Pros and Cons of Cloning
  • Honors Bio Read The Real Face of Cloning

10
DNA Technology ex Gene Therapy
  • Treatment of a genetic disorder (like cystic
    fibrous) by correcting a defective gene that
    causes a deficiency of an enzyme.
  • Nasal spray that carries normal enzyme gene. Body
    makes enzyme and patient breathes normally.
    Regular treatments necessary
  • Has not been proven to be successful in the long
    term

11
How do we copy a piece of DNA..The Tools
  • DNA Extraction Chemical procedure (well do
    this)
  • Restriction enzymes molecular scissors that cut
    DNA at specific nucleotide sequences
  • Gel Electrophoresis method to analyze fragments
    of DNA cut by restriction enzymes through a gel
    made of agarose (molecular sieve)
  • DNA Ligase molecular glue that puts pieces of
    DNA together
  • Polymerase Chain Reaction (PCR)- molecular copy
    machine. Makes millions of copies of DNA/hr

12
Lets suppose that you are a diabetic and can not
make your own insulin. What are you to do?
  • Inject insulin of course but from what source?
  • Old method was to use sheep insulin. Costly and
    labor intensive
  • New method Let bacteria with a human insulin
    producing gene make it for you

13
The Method
  • Transformation of a bacterium to produce human
    insulin
  • 1. Extract the insulin producing gene from a
    healthy human
  • 2. Using a restriction enzyme, cut the insulin
    producing gene out of a the DNA

14
What are restriction enzymes?
  • Bacterial enzymes used to cut bacteriophage DNA
    (viruses that invade bacteria).
  • Different bacterial strains express different
    restriction enzymes
  • Restriction enzymes recognize a specific short
    nucleotide sequence
  • For example, Eco RI recognizes the sequence
  • 5 - G A A T T C - 3
  • 3 - C T T A A G - 5
  • Pandindrones same base pairing forward and
    backwards

15
(No Transcript)
16
Lets try some cutting
  • Using this piece of DNA, cut it with Eco RI
  • G/AATTC
  • GACCGAATTCAGTTAATTCGAATTC
  • CTGGCTTAAGTCAATTAAGCTTAAG
  • GACCG/AATTCAGTTAATTCG/AATTC
  • CTGGCTTAA/GTCAATTAAGCTTAA/G

17
What results is
  • GACCG AATTCAGTTAATTCG
    AATTC
  • CTGGCTTAA GTCAATTAAGCTTAA
    G

Sticky end - tails of DNA easily bind to other
DNA strands
Sticky end
18
Blunt Sticky ends
  • Sticky ends Creates an overhang. EcoRI
  • Blunts- Enzymes that cut at precisely opposite
    sites without overhangs. SmaI is an example of an
    enzyme that generates blunt ends

19
Cloning Vectors
  • Cloning vector is a carrier that is used to clone
    a gene and transfer it from one organism to
    another.
  • Many bacteria contain a cloning vector called a
    PLASMID.
  • PLASMID ? is a ring of DNA found in a bacterium
    in addition to its main chromosome

20
3. Cut cloning vector
  • Use bacterial plasmids
  • Plasmids will be cut with the same restriction
    enzyme used to cut the desired gene

21
  • 4. Ligation - Donor gene (desired gene) is then
    spliced or annealed into the plasmid
  • using DNA ligase as the glue.
  • Recombinant DNA - DNA with new piece of
    genetic information on it
  • 5. Plasmid is then returned to bacterium and
    reproduces with donor gene in it.
  • Transgenic organism organism with foreign
    DNA incorporated in its genome (genes)
  • 6. Bacterium reproduces and starts producing
    human insulin gene which we harvest from them.

22
Recombinant DNA
Donor Gene
23
(No Transcript)
24
Expression of Cloned Genes
  • Sometimes PROMOTERS must also be transferred so
    the genes will be turned on.
  • Genes are often turned off until the proteins
    they code for are needed.

25
How can you get a desired trait without directly
manipulating the organisms DNA?
  1. HYBRIDIZATION crossing organisms of different
    traits to produce a hardier product ex mule
  2. INBREEDING/SELECTIVE BREEDING maintain the
    present genes by breeding only within the
    population ex pedigree animals
  3. INDUCING MUTATIONS radiation, chemicals ?
    polyploidy (3N or 4N) plants resulted ? larger
    and hardier

26
Now let us manipulate the genes by altering the
organisms DNA
  1. DNA Technology sci. involved in the ability to
    manipulate genes/DNA
  2. Cure disease
  3. treat genetic disorders
  4. Improve crops

27
Tools
  1. DNA extraction
  2. Restriction enzymes
  3. Gel electrophoresis
  4. DNA ligase
  5. Polymerase chain rxn. (PCR)

28
Method (5 steps)
  • Extract gene ? insulin
  • Cut insulin producing gene out using restriction
    enzymes
  • Sticky ends ? create overhang
  • Blunts? no overhangs
  • Cutting clone vector? cut plasmid with same
    restriction enzyme
  • Ligation donor gene is spliced into plasmid
    DNA, DNA ligase glues it
  • (this forms recombinant DNA plasmid DNA new
    piece of DNA)
  • Plasmid returned to bacterium reproduces using
    donor gene in it (this is transgenic organism
    organism with foreign DNA incorporated in its
    genome)
  • reproduce

29
Restriction Enzymes
  • BACTERIAL ENZYMES are used to cut DNA molecule
    into more manageable pieces
  • They recognize certain sequences
  • Creating single-chain tails in DNA ? called
    STICKY ENDS

30
Sticky Ends
  • Readily bind to complimentary chains of DNA
    therefore pieces of DNA that have been cut with
    the same restriction enzyme can bind together to
    form a new sequence of nucleotides
  • Recognizes ? CTTAAG

31

32

33
Cloning Vectors
  • Cloning vector is a carrier that is used to clone
    a gene and transfer it from one organism to
    another.
  • Many bacteria contain a cloning vector called a
    PLASMID.
  • PLASMID ? is a ring of DNA found in a bacterium
    in addition to its main chromosome.

34
PROCEDURE
  • To be used as a cloning vector in gene transfer
    experiments a plasmid is isolated from a
    bacterium.
  • Using restriction enzymes the plasmid is then cut
    and a DONOR GENE (specific gene isolated from
    another organism is spliced into it)
  • Then the plasmid is returned to the bacterium,
    where it is replicated as the bacterium divides,
    making copies of the donor gene.
  • Plasmid now contains a GENE CLONE

35

36
Cloning Vectors
  • !

37
Plasmid

38
Transplanting genes
  • In some cases, plasmids are used to transfer a
    gene to bacteria so that the bacteria will
    produce a specific protein
  • Ex INSULIN protein that controls sugar
    metabolism
  • Bacteria that receives the gene for insulin will
    produce insulin as long as the gene is not turned
    off

39
Steps
  • 1. ISOLATING A GENE isolate the DNA from human
    cells and plasmids from the bacteria
  • Use restriction enzyme
  • Splice human DNA into plasmids to create a
    genomic library (set of thousands of DNA pieces
    from a genome that have been inserted into a
    cloning vector)

40
Steps cont
  • 2. PRODUCING RECOMBINANT DNA combination of DNA
    from 2 or more sources
  • Inserting a donor gene such as human gene for
    insulin, into a cloning vector, such as bacterial
    plasmid results in a recombinant DNA molecule!

41
Steps cont
  • 3. CLONING DNA the plasmid containing recomb.
    DNA is inserted into a host bacterium (called
    transgenic organism
  • The trans. Bact. Is placed in a nutrient medium
    where it can grow and reproduce.

42

43

44
Expression of Cloned Genes
  • Sometimes PROMOTERS must also be transferred so
    the genes will be turned on.
  • Genes are often turned off until the proteins
    they code for are needed.

45
Practical uses of DNA Technology
  1. Pharmaceutical products insulin, HBCF (human
    blood clotting factor)
  2. Genetically engineered vaccines
  3. Increased agriculteral yields
  4. Improving quality of produce
  5. Slow down ripening
  6. Enhance color
  7. Reduce fuzz
  8. Increase flavor
  9. Frost resistance

46
Negatives
  • Allergies
  • Labels dont include all information
  • May create super weeds

47
Gene therapy
  • Treatment of genetic disorders
  • Ex cystic fibrosis

48
DNA Technology Techniques
  • I. DNA Fingerprints ? pattern of bands made up
    of specific fragments from an individuals DNA
  • USED FOR
  • DETECTION OF A RELATIVE
  • SIMILARITIES BETWEEN SPECIES

49
How do you make DNA fingerprints?
  • RFLP (restriction fragment length polymorphism)
    analysis
  • 1. extract DNA from specimen using restriction
    enzymes
  • 2. separate fragments of DNA using
    electrophoresis (separates DNA according to size
    and charge)
  • 3. placed in wells made on gel and run electric
    current through gel
  • 4. blotted onto filter paper/ photgraphic film.

50
How do you make DNA fingerprints?
  • RFLP (restriction fragment length polymorphism)
    analysis
  • 1. extract DNA from specimen using restriction
    enzymes
  • 2. separate fragments of DNA using
    electrophoresis (separates DNA according to size
    and charge)
  • 3. placed in wells made on gel
  • 4. electric current run through gel

51
Continue
  • 5. negative fragments migrate to positive
    charged end of gel but not all at same rate
  • 6. pores in gel allow smaller fragments to
    migrate faster ? separating fragments by size.
  • 7. blotted onto filter paper.

52
Can you tell if this could be the father?
53
Accuracy of DNA Fingerprints
  • DNA fingerprints are very accurate
  • However, genetic tests can only absolutely
    disprove, not prove, relationship!
  • Courts accept 99.5 accuracy as proof of alleged
    paternity

54
Polymerase Chain Reaction (PCR)
  • Used when you only have a TINY piece of DNA
  • PCR can be used to quickly make many copies of
    selected segments of the available DNA
  • Use a PRIMER to initiate replication
  • DNA doubles every 5 minutes

55
PCR is used for
  • 1. crimes
  • 2. diagnosing genetic disorders from embryonic
    cells
  • 3. studying ancient fragments of DNA (tiny
    amounts)

56
HUMAN GENOME PROJECT
  • 2 GOALS
  • 1. determine nucleotide sequence of entire human
    genome (aprox 3 billion nucleotide pairs or about
    100,000 genes
  • 2. map the location of every gene on each
    chromosome

57
1996
  • 1 of 3 billion nucleotide pairs of DNA human
    genomes were analyzed
  • This allows for us to identify and determine the
    function of 16,000 genes!

58
Gene Therapy
  • Treating a genetic disorder by introducing a gene
    into a cell or by correcting a gene defect in a
    cells genome.
  • Ex Cyctic fibrosis ?cause one defective gene ?
    malfunction of one protein

59
Gene Therapy for Cyctic Fibrosis
  • Nasal spray carrying normal cyctic fibrosis gene
    to cells in nose and lungs
  • Must repeat treatment periodically

60
Ethical Issues
  • Many people worry about how personal genetic
    information will be used
  • Insurance???
  • Employment????
  • Human Genome Project will undoubtedly involve
    ethical decisions about how society should use
    the information! WHAT DO YOU THINK??

61
Practical Uses of DNA Technology
  • 1. produce perscription drugs
  • Vaccine (harmless version of a virus or a
    bacterium)
  • Pathogen (disease causing agent) treated
    chemically or physically so that they can no
    longer cause disease.
  • Pathogen (Ag) ? Antibody (Ab)
  • DNA tech. may produce vaccines safer than
    traditional ones!

62
Increasing Agricultural Yields
  • DNA Tech. ? used to develop new strains of
    plants
  • Ex scientists can make tomato plants toxic to
    hornworms and effectively protect the plant from
    these pests.

63
See the hornworm beginning to form at the leaves!
64
This hornworm eats and destroys the tomato plant!
65
Hornworms attack tomato plants
66
Crops that do NOT need fertilizer
  • Plants require NITROGEN to make proteins and
    nucleic acids
  • Most plants get their N from the soil
  • TRANSGENIC FOOD CROPS ? contain genes for
    nitrogen fixation so they can grow in nitrogen
    POOR soil.

67
Genetically Engineered Foods
  • Foods may have toxic proteins or substances ?
    causing ALLERGIES
  • Ex changing the gene that codes for an enzyme
    to ripening in tomatoes they are able to make
    tomatoes ripen without becoming SOFT!!

68
Genetically Engineered Crops
  • Some are concerned that genetically engineered
    crops could spread into the wild and wipe out
    native plant species.
  • SUPERWEEDS!!!!!!!!
About PowerShow.com