BIOTECHNOLOGY - PowerPoint PPT Presentation

Loading...

PPT – BIOTECHNOLOGY PowerPoint presentation | free to download - id: 7f8d66-NDU4Z



Loading


The Adobe Flash plugin is needed to view this content

Get the plugin now

View by Category
About This Presentation
Title:

BIOTECHNOLOGY

Description:

... INDUSTRIAL Let s model/simulate how to create recombinant DNA using bacterial ... vaccines Cows produce ... 1_Module 2_Module 3_Module 4 ... – PowerPoint PPT presentation

Number of Views:13
Avg rating:3.0/5.0
Slides: 83
Provided by: Susan892
Learn more at: http://lindsaymathisbiology.weebly.com
Category:

less

Write a Comment
User Comments (0)
Transcript and Presenter's Notes

Title: BIOTECHNOLOGY


1
BIOTECHNOLOGY
  • How can we use DNA to help humans?

2
DNA Fingerprinting
  • Each individual (except clones and identical
    twins) has a unique DNA sequence.
  • This sequence can be used to produce a DNA
    fingerprint, a unique band pattern of DNA
    fragments.

3
Fill It In
  • Compare a DNA fingerprint with a typical
    fingerprint

4
DNA Fingerprinting
  • A DNA fingerprint is produced using a gel
    electrophoresis.
  • A gel electrophoresis is a machine that separates
    pieces of DNA based on size (the number of base
    pairs)

5
DNA Fingerprinting
  • The process of producing a DNA fingerprint can be
    described in three basic steps
  • 1. A restriction enzyme is used to cut the DNA
    sample into pieces. A restriction enzyme binds
    to a specific sequence of DNA bases, called a
    restriction site, and cuts (cleaves) the DNA
    between two of the bases in that site. This
    produces many pieces of different sizes.

6
DNA Fingerprinting
  • The process of producing a DNA fingerprint can be
    described in three basic steps
  • 2. Once the restriction enzymes have recognized
    all the restriction sites and have cleaved the
    DNA into pieces, the sample is loaded into a gel
    for electrophoresis.

7
DNA Fingerprinting
  • The process of producing a DNA fingerprint can be
    described in three basic steps
  • Electricity forces the DNA pieces to move through
    the gel. Smaller pieces are able to move farther
    than larger pieces. The electrophoresis creates
    a separation of pieces by size - making a column
    of bands.

8
Gel electrophoresis
  • A method of separating DNA in a gelatin-like
    material using an electrical field
  • DNA is negatively charged
  • when its in an electrical field it moves toward
    the positive side

DNA ? ? ? ? ? ? ?


swimming through Jello
9
DNA Fingerprinting
  • The process of producing a DNA fingerprint can be
    described in three basic steps
  • 3. The DNA sequence of different individuals
    will have different numbers of restriction sites,
    or restriction sites in slightly different
    places. The variation of restriction sites means
    that an individuals band pattern will likely be
    different from other individuals.

10
DNA fingerprint
  • Why is each persons DNA pattern different?
  • sections of junk DNA
  • doesnt code for proteins
  • made up of repeated patterns
  • CAT, GCC, and others
  • each person may have different number of repeats
  • many sites on our 23 chromosomes with different
    repeat patterns

GCTTGTAACGGCCTCATCATCATTCGCCGGCCTACGCTT CGAACATTGC
CGGAGTAGTAGTAAGCGGCCGGATGCGAA
GCTTGTAACGGCATCATCATCATCATCATCCGGCCTACGCTT CGAACAT
TGCCGTAGTAGTAGTAGTAGTAGGCCGGATGCGAA
11
DNA Fingerprinting
  • The process of producing a DNA fingerprint can be
    described in three basic steps
  • 3. By comparing band patterns, we can determine
    many things.

12
Uses Forensics
  • Comparing DNA sample from crime scene with
    suspects victim

suspects
crime scene sample
S1
S2
S3
V

DNA ?

13
Fill It In
  • Find ONE WORD that describes each of the three
    steps of making a DNA fingerprint. A hint is
    given! Write the word below
  • C_______
  • E_______
  • C_______

14
DNA fingerprints can be used for several
applications
  • A DNA Fingerprint can be used for several
    reasons. A DNA fingerprint can be used to
    identify an individual, or determine the source
    of DNA left at a crime scene.
  • Example a bloody knife was found a short
    distance from a murder victim. Two suspects have
    been identified
  • Blood on Knife Victim Suspect A Suspect B
  • ____ ____
    ____
  • ____
    ____
  • ____ ____
    ____
  • ____ ____
  • ____ ____

    ____ ____

15
DNA fingerprints can be used for several
applications
  • Explanation the blood on the knife came from two
    sources - the victim and another person (we can
    eliminate the bands of the victim, but other
    bands remain). By comparing the remaining bands,
    it is clear that Suspect A is cleared, and
    Suspect B is . suspect
  • Blood on Knife Victim Suspect A Suspect B
  • ____ ____
    ____
  • ____
    ____
  • ____ ____
    ____
  • ____ ____
  • ____ ____

    ____ ____

16
Fill It In
  • Highlight the shortest piece of DNA in this
    fingerprint.
  • Blood on Knife Victim Suspect A Suspect B
  • ____ ____
    ____
  • ____
    ____
  • ____ ____
    ____
  • ____ ____
  • ____ ____

    ____ ____
  • What tool/process was used to create this
    fingerprint?

17
Electrophoresis use in forensics
  • Evidence from murder trial
  • Do you think suspect is guilty?

blood sample 1 from crime scene
blood sample 2 from crime scene
blood sample 3 from crime scene
standard
blood sample from suspect
OJ Simpson
blood sample from victim 1
N Brown
blood sample from victim 2
R Goldman
standard
18
DNA fingerprints can be used for several
applications
  • A DNA Fingerprint can be used to determine the
    paternity of a child.

19
Uses Paternity
  • Whos the father?


DNA ?

20
DNA fingerprints can be used for several
applications
  • Example a millionaire has been charged with
    several paternity cases. His lawyer ordered DNA
    Fingerprints
  • Richy Rich Mother A Child A
    Mother B Child B
    Mother C Child C
  • _____ _____ _____
    _____
  • _____ _____
  • _____ _____
  • _____ _____ _____
  • _____
  • _____ _____
  • _____ ____
    _____
  • _____ _____
  • _____ _____
    _____

21
DNA fingerprints can be used for several
applications
  • Explanation because half of your DNA is
    inherited from your mother and half from your
    father, each band in a childs patter will also
    appear in either the pattern of the mother or of
    the father.
  • Richy Rich Mother A
    Child A Mother B
    Child B Mother C
    Child C
  • _____ _____ _____
    _____
  • _____ _____
  • _____ _____
  • _____ _____ _____
  • _____
  • _____ _____
  • _____ _____
    _____
  • _____ _____
  • _____ _____
    _____

22
DNA fingerprints can be used for several
applications
  • Explanation Child A could NOT be Richy Richs
    child because of the third band in the childs
    pattern. Child C could NOT be Richy Richs child
    based on the third band in the childs pattern.
    Child B COULD be Richy Richs child.
  • Richy Rich Mother A
    Child A Mother B
    Child B Mother C
    Child C
  • _____ _____ _____
    _____
  • _____ _____
  • _____ _____
  • _____ _____ _____
  • _____
  • _____ _____
  • _____ _____
    _____
  • _____ _____
  • _____ _____
    _____

23
Fill It In
  • How is analyzing a DNA fingerprint for paternity
    DIFFERENT than analyzing a fingerprint to
    identify an individuals DNA from a crime scene?

24
Uses Evolutionary relationships
  • Comparing DNA samples from different organisms to
    measure evolutionary relationships

turtle
snake
rat
squirrel
fruitfly

DNA ?

25
DNA fingerprints can be used for several
applications
  • DNA fingerprinting can be used to catalog
    endangered species.
  • For example, researchers have developed DNA banks
    of endangered species protected by law.
  • This allows them to prove if endangered species
    are used in products, such as medicines or food.

26
Check Yourself!
  1. What is a DNA Fingerprint?
  2. What technology is used to make a DNA
    Fingerprint?
  3. What type of enzymes are used to cut DNA?
  4. What are three uses for DNA fingerprinting?

27
Check Yourself!
  1. What is a DNA Fingerprint? A UNIQUE BAND OF DNA
    FRAGMENTS
  2. What technology is used to make a DNA
    Fingerprint?
  3. What type of enzymes are used to cut DNA?
  4. What are three uses for DNA fingerprinting?

28
Check Yourself!
  1. What is a DNA Fingerprint? A UNIQUE BAND OF DNA
    FRAGMENTS
  2. What technology is used to make a DNA
    Fingerprint? GEL ELECTROPHORESIS
  3. What type of enzymes are used to cut DNA?
  4. What are three uses for DNA fingerprinting?

29
Check Yourself!
  1. What is a DNA Fingerprint? A UNIQUE BAND OF DNA
    FRAGMENTS
  2. What technology is used to make a DNA
    Fingerprint? GEL ELECTROPHORESIS
  3. What type of enzymes are used to cut DNA?
    RESTRICTION ENZYMES
  4. What are three uses for DNA fingerprinting?

30
Check Yourself!
  • What is a DNA Fingerprint? A UNIQUE BAND OF DNA
    FRAGMENTS
  • What technology is used to make a DNA
    Fingerprint? GEL ELECTROPHORESIS
  • What type of enzymes are used to cut DNA?
    RESTRICTION ENZYMES
  • What are three uses for DNA fingerprinting?
  • CRIME SCENE INVESTIGATION
  • DETERMINING PATERNITY
  • CATALOG ENDANGERED SPECIES

31
Who Stole the Lollypop?
  • Who Stole the Lollypop?
  • A Link for the Missing
  • DNA Fingerprint Lab turn it in
  • DNA Fingerprint Practice

32
Genetic Engineering
  • Video Genetic Modification (PBS Learning Media)

33
Genetic Engineering
p. 87
  • Genetic engineering is the modification of DNA.
  • Modification means changing, such as adding or
    removing parts of the DNA sequence.

34
Genetic Engineering
  • Genetic engineering may be used to produce a
    transgenic organism (an organism which contains
    foreign DNA) to use in gene therapy or gene
    cloning.

35
Fill It In
  • WORD HELP!
  • trans means to __________
  • genic means ___________

36
Genetic engineering can be used for several
applications
  • Genetic engineering can be used to create a
    transgenic organism

37
Genetic engineering can be used for several
applications
  • Restriction enzymes are used to cleave the
    foreign DNA source in order to isolate the
    desired gene.
  • For example, removing the insulin gene from human
    DNA

38
Genetic engineering can be used for several
applications
  • The same restriction enzyme is used to cleave the
    vector (which may be a bacterial plasmid).
  • A vector is the structure used to carry the
    foreign DNA.

39
Genetic engineering can be used for several
applications
  • The foreign DNA fragment (the desired gene) and
    the vector are combined/spliced together.

40
Genetic engineering can be used for several
applications
  • The combination is possible for two reasons.
  • First, DNA is similar in all organisms.
  • Second, the same restriction enzyme is used on
    both samples of DNA

41
Genetic engineering can be used for several
applications
  • The combined DNA (called recombinant DNA) is
    inserted into the host (which may be a bacteria
    cell)
  • The host cell will copy/clone the recombinant DNA
    as it reproduces and will produce the protein
    (such as insulin) from the desired gene during
    protein synthesis.

42
Genetic engineering can be used for several
applications
43
Fill It In
  • How are each of the words related to genetic
    engineering?
  • Vector -
  • Recombinant DNA -
  • Host cell -

44
Fill It In
  • Find ONE WORD that completes the short
    description of each of the four steps. A hint is
    given! Write the word below
  • C_________ DNA
  • V_________ opened
  • C_________ together
  • I__________ into host

45
Weird Science!
  • 5 percent of U.S. corn and 85 percent of U.S.
    soybeans are genetically engineered, and its
    estimated that 70 to 75 percent of processed
    foods on grocery store

46
Glow in the dark cats
47
Enviropig
  • Digest and process phosphorus

48
Pollution- fighting plants
  • Absorb and clean soil through their roots

49
Venomous Cabbage
  • Scorpion Venom to kill caterpillars but not
    harmful to humans

50
Web Spinning Goats
  • Silk protein in their milk

51
Fast Growing Samon
52
Flavr Savr Tomato
  • Slow ripening time

53
Vaccine Banana
  • People may soon be getting vaccinated for
    diseases like hepatitis B and cholera by simply
    taking a bite of banana.
  • Researchers have successfully engineered bananas,
    potatoes, lettuce, carrots and tobacco to produce
    vaccines

54
Less-flatulent cows
  • Cows produce significant amounts of methane as a
    result of their digestion process its produced
    by a bacterium thats a byproduct of cows
    high-cellulosic diets that include grass and hay

55
GM Trees!
  • Grow Faster
  • Freezing temperatures,
  • Loblolly pines have been created with less
    lignin, the substance that gives trees their
    rigidity.
  • In 2003, the Pentagon even awarded Colorado State
    researchers 500,000 to develop pine trees that
    change color when exposed to biological or
    chemical attack.

56
Medicine Eggs
  • British scientists have created a breed of
    genetically modified hens that produce
    cancer-fighting medicines in their eggs.
  • The animals have had human genes added to their
    DNA so that human proteins are secreted into the
    whites of their eggs, along with complex
    medicinal proteins similar to drugs used to treat
    skin cancer and other diseases

57
Super carbon-capturing plants
  • Absorb more carbon dioxide

58
Genetic engineering can be used for several
applications
  • Genetic engineering may be used for gene therapy.

59
Genetic engineering can be used for several
applications
  • Gene therapy has been used to treat Severe
    Combined Immunodeficiency (SCID) and cystic
    fibrosis (CF).
  • It has been shown to be safe for up to 10 years
    to treat SCID, but patients have the risk of
    developing leukemia

60
Genetic engineering can be used for several
applications
  • Gene therapy has been used to treat Severe
    Combined Immunodeficiency (SCID) and cystic
    fibrosis (CF).
  • In treating cystic fibrosis, the results hav been
    limited because the patients immune system is
    fighting off the virus used to carry the correct
    gene to the target cells.

61
Genetic engineering can be used for several
applications
  • Defective genes are identified within the DNA
    sequence.
  • Individuals may be tested for the presence of the
    defective gene (for example, the IL2RG gene in
    SCIDS)

62
Genetic engineering can be used for several
applications
  • A functioning gene isolated from a donors DNA is
    packaged into a vector/carrier (such as a cold
    virus used for CF gene therapy)

63
Genetic engineering can be used for several
applications
  • The vector is introduced to the organism with the
    defective gene.
  • The functioning gene is delivered to target cells
    and randomly inserts itself into the DNA (this is
    what likely caused the leukemia in the SCID
    treatment).
  • Now the cell can produce the correct protein.

64
Genetic engineering has many practical purposes
  • Medical applications include producing large
    quantities of human proteins (such as insulin and
    human growth hormone) cheaply and providing
    animal models of human genetic diseases (such as
    knock-out mice)

Genetic Engineering
65
Genetic engineering has many practical purposes
  • Agricultural applications include producing
    plants that are herbicide or pest resistant and
    plants that have higher nutritional value.
  • These plants are commonly called GMOs
    (genetically-modified organisms)

66
Genetic engineering has many practical purposes
  • Industrial uses include using mircoorganisms to
    clean up mining waste, sewage treatment, and
    environmental disasters.

67
Genetic engineering raises serious bioethical
concerns
  • The question may need to be Should we? instead
    of Could we?
  • For example, should we alter the natural
    variation of human genes by genetic engineering?

68
Genetic engineering raises serious bioethical
concerns
  • Creating plants with new genes may trigger
    allergic reactions in unsuspecting consumers.
  • For example, a gene from a peanut plant to a corn
    plant in order to increase nutrition may cause an
    allergic reaction in some people.

69
Genetic engineering raises serious bioethical
concerns
  • Creating organisms that are not naturally
    occurring may create problems in the environment
    or for humans.
  • For example, an oil digesting bacteria may get
    into oil-digesting bacteria may get into
    oil-based machinery and our oil supplies.

70
Check Yourself!
  1. What is genetic engineering?
  2. What is a transgenic organism?
  3. How are restriction enzymes used in genetic
    engineering?
  4. What is gene therapy?
  5. List two practical applications of genetic
    engineering.

71
Check Yourself!
  1. What is genetic engineering?
    THE
    MODIFICATION OF DNA
  2. What is a transgenic organism?
  3. How are restriction enzymes used in genetic
    engineering?
  4. What is gene therapy?
  5. List two practical applications of genetic
    engineering.

72
Check Yourself!
  1. What is genetic engineering?
    THE
    MODIFICATION OF DNA
  2. What is a transgenic organism? AN ORGANISM
    CONTAINING FOREIGN DNA
  3. How are restriction enzymes used in genetic
    engineering? CLEAVE/CUT DNA AT A SPECIFIC
    NUCLEOTIDE SEQUENCE
  4. What is gene therapy?
  5. List two practical applications of genetic
    engineering.

73
Check Yourself!
  1. What is genetic engineering?
    THE
    MODIFICATION OF DNA
  2. What is a transgenic organism? AN ORGANISM
    CONTAINING FOREIGN DNA
  3. How are restriction enzymes used in genetic
    engineering? CLEAVE/CUT DNA AT A SPECIFIC
    NUCLEOTIDE SEQUENCE
  4. What is gene therapy? A TECHNIQUE THAT USES
    GENES TO TREAT OR PREVENT DISEASES/DISORDERS
  5. List two practical applications of genetic
    engineering.

74
Check Yourself!
  • What is genetic engineering?
    THE
    MODIFICATION OF DNA
  • What is a transgenic organism? AN ORGANISM
    CONTAINING FOREIGN DNA
  • How are restriction enzymes used in genetic
    engineering? CLEAVE/CUT DNA AT A SPECIFIC
    NUCLEOTIDE SEQUENCE
  • What is gene therapy? A TECHNIQUE THAT USES
    GENES TO TREAT OR PREVENT DISEASES/DISORDERS
  • List two practical applications of genetic
    engineering.
  • MEDICAL, AGRICULTURAL, INDUSTRIAL

75
Genetic Engineering Lab
  • Lets model/simulate how to create recombinant
    DNA using bacterial plasmids
  • You need
  • Scissors
  • Tape (share)
  • 1 Activity sheet
  • 1 pink strip of DNA
  • 1 blue strip of DNA

76
Genetic Engineering Activity
  1. Step 1 Cleave Donor DNA (pink strip)
  2. Step 2 CLEAVE PLASMID (blue strip)
  3. Step 3 PRODUCE RECOMBINANT DNA.
  4. Step 4 CLONE CELLS.
  5. Step 5 SCREEN CELLS.

77
Warm-up
  • Answer 1-4 under Genetic Engineering Checkpoint
  • Papers will be returned.
  • Put the following in your portfolio
  • Disease Brochure and Rubric
  • CE 3 and 4
  • HGP Article Questions

78
Summarizing Recombinant DNA
  1. Answer 1-7 at the bottom on your own.
  2. WHEN YOU FINISH, check/compare answers with
    someone near you.
  3. Turn it over and do the back side!

79
(No Transcript)
80
(No Transcript)
81
Genetically Modified Foods
  • A Close Reading
  • Read the article silently to yourself. As you
    read, use the following annotations
  • Highlight important/key ideas (any color)
  • Blue ! things that are interesting or
    surprising
  • Red ? things you have a question about

82
Genetically Modified Foods
  • With those in your group
  • Share out your key points/main ideas
  • Make a list of 2-3 main/key ideas on the index
    card
  • Share out your surprising/interesting facts
  • Write 1 or 2 interesting/surprising things you
    learned on sticky notes (be ready to share with
    class)
  • Share out your questions
  • Write 1 or 2 questions you had from reading the
    article on sticky notes (be ready to share with
    class)
About PowerShow.com