Results%20of%20donor%20screening%20with%20nucleic%20acid%20amplification%20tests%20(NAT)%20and%20implications%20for%20HIV%20research,%20diagnosis%20and%20surveillance - PowerPoint PPT Presentation

View by Category
About This Presentation
Title:

Results%20of%20donor%20screening%20with%20nucleic%20acid%20amplification%20tests%20(NAT)%20and%20implications%20for%20HIV%20research,%20diagnosis%20and%20surveillance

Description:

Results of donor screening with nucleic acid amplification tests (NAT) and implications for HIV research, diagnosis and surveillance Michael P. Busch, MD, PhD – PowerPoint PPT presentation

Number of Views:101
Avg rating:3.0/5.0

less

Write a Comment
User Comments (0)
Transcript and Presenter's Notes

Title: Results%20of%20donor%20screening%20with%20nucleic%20acid%20amplification%20tests%20(NAT)%20and%20implications%20for%20HIV%20research,%20diagnosis%20and%20surveillance


1
Results of donor screening with nucleic acid
amplification tests (NAT) and implications for
HIV research, diagnosis and surveillance
  • Michael P. Busch, MD, PhD Professor of Laboratory
    Medicine, UCSF Director, Blood Systems Research
    Institute

2
Overview of presentation
  • RNA dynamics in primary HIV infection and
    projected yield of NAT in low and high incidence
    populations
  • Design of NAT assays for blood screening
  • Yield and cost effectiveness of NAT screening of
    blood donors
  • Applications of donor NAT assays in research
    settings

3
HIV Viremia during early infection
Peak viremia 106-108 gEq/mL
HIV RNA (plasma)
Ramp-up viremia DT 21.5 hrs
HIV Antibody
HIV p24 Ag
p24 Ag EIA -
Viral set-point 102 -105 gEq/mL
HIV MP-NAT -
1st gen
2nd gen
HIV ID-NAT -
3rd gen
blip viremia
11
16
22
4
AIDS, 171871-9, 2003.
5
AIDS, 171871-9, 2003
6
Time Table of HIV Stage Progression based on 51
Seroconverting Plasma Donors
Stage Marker Marker Marker Marker Marker Duration in Days (95 CI)
Stage RNA p24 Ag Ab (EIA) Ab (EIA) WB Duration in Days (95 CI)
I - - - - 5.0 (3.1, 8.1)
II - - - 5.3 (3.7, 7.7)
III - - 3.2 (2.1, 4.8)
IV /- - IND 5.6 (3.8, 8.1)
V /- /- 69.5 (39.7, 121.7)
VI /- open-ended
without p31 band calculations are based
on a parametric Markov model
AIDS, 171871-9, 2003.
7
Individual Rates and Linear Regression Model of
HIV RNA Production during Early Infection.
9
N 97 Samples from 44 Plasma donors DT 21.5 hrs
(95 CI 19.2-24.6)
8
LOG HIV RNA gEq/mL
7
6
5
4
3
2
1
-10
-5
0
5
10
15
20
Day
8
Projected WP Closure and Yield of p24 Ag, MP
and ID NAT Assays Relative to a Sensitive HIV-EA
Antibody Test in the Detection of WP HIV Infection
Assay Sensitivity gEq / mL WP Closure days Yield, WP HIV Infections per 1,000 Persons Tested in Various Screening Settings Representative Incidence Rate / Person-Years Yield, WP HIV Infections per 1,000 Persons Tested in Various Screening Settings Representative Incidence Rate / Person-Years Yield, WP HIV Infections per 1,000 Persons Tested in Various Screening Settings Representative Incidence Rate / Person-Years
Assay Sensitivity gEq / mL WP Closure days Blood Donors 2 / 100,000 0.002 STD Clinic 1 / 1,000 0.1 High Risk Clinic 1 / 10 10
p24 Ag 10,000 6 0.00033 0.016 1.6
MP NAT 1,000 9 0.00049 0.025 2.5
ID NAT 50 13 0.00071 0.036 3.6
AIDS, 171871-9, 2003
9
Proposed Laboratory Stages of Primary HIV
Infection with Semiquantitative Plot of HIV
Assay Reactivities
10
Representative HIV Conversion Panels with
Pre-Ramp-Up Blip Viremia (RNA blip observed
in 7/19 informative panels)
Days from First MP-PCR Test p24 Ag HIV-1 Ab HIV-1 RNA (copies / mL) Pos / Replicate PCR
- 21 Neg Neg lt 100 1 / 10
- 19 Neg Neg lt 100 7 / 8
- 14 Neg Neg lt 100 0 / 8
- 11 Neg Neg lt 100 0 / 8
- 7 Neg Neg lt 100 0 / 8
- 4 Neg Neg lt 100 3 / 8
0 Neg Neg 260 5 / 5
3 Neg Neg 27,000
7 Pos Neg 370,000
9 Pos Neg 2,800,000
16 Pos REACT 410,000
Alpha / BCP Case 1012
11
(No Transcript)
12
New Test Implementation and Declining Risk of
Viral Infections from Transfusion
Busch et al. JAMA 2003 289 959-962
13
Advances in NAT systems for blood donor screening
  • Fully automated platforms
  • Bar coded tubes to validated electronic results
  • Generic extraction of RNA/DNA
  • Internal controls to verify amplification
  • Multiplex or parallel detection of mulitple
    viruses (Taqman, beacon or DKA strategies)
  • Primers selected to amplify divergent subtypes
  • Rapid response to emerging pathogens

14
TIGRIS Fully Automated NAT System
15
Procleix Specimen Processing Target
Capture/Magnetic Microparticle Separation
  • Viral Lysis
  • Treat specimens with heat and detergent
  • Release nucleic acid
  • Nucleic Acid Capture
  • Hybridize target sequence to capture probes
  • Hybridize capture probe to oligomer sequence
    bind to magnetic particle
  • Removal of unwanted specimen
  • Apply magnetic field to separate target from
    residual sample
  • Remove residual specimen by washing

TTTTTTTTTTTTTT
TTTTTTTTTTTTTT
Magnetic Microparticle
TTTTTTTTTTTTTT
Target RNA or DNA
Magnet
5 GUAGAUUGGCA 3
3 AAAAAAAAACAUCUAACCGU 5
TTTTTTTTTTTTTT
TTTTTTTTTTTTTT
Capture Oligo
16
Procleix Detection Dual Kinetics Analysis (DKA)
  • Used to differentiate Internal Control (IC)
    signal from target signal
  • Utilizes Acridinium Ester (AE) labeled probes
    with differential kinetics of light-off
  • Ortho Fluoro Acridinium Ester labeled probe
    flasher probe, hybridizes to IC
  • 2Methyl Acridinium Ester labeled probes Glower
    probes, hybridize to West Nile virus amplicon
  • ETF Algorithm deconvolutes light-off and
    calculates each signal

RLU
Background
Flasher
Glower
1
4
7
10
13
16
19
22
25
28
31
34
37
40
43
46
49
Interval
17
Analytical Sensitivity, HIV-1
Chiron Procleix HIV-1/HCV Assay and HIV-1
Discriminatory Assay
HIV/HCV, Lot A HIV Discr, Lot A HIV/HCV, Lot
B HIV Discr, Lot B
Positivity rate
50 detection at 8 Copies/ml
Copies/ml
18
Roche Fully Automated TaqScreen System
COBAS TaqMan
Hamilton Pipettor
COBAS AmpliPrep
19
TaqMan 5' Nuclease Assay Fluorescence Energy
Transfer Probe
20
Testing Algorithm for Plasma Pools
using Chiron/G-P Procleix Assays
Plasma Pools
Chiron Procleix HIV-1/HCV Assay
Non-Reactive Pools
Reactive Pools
Chiron Procleix HIV-1/HCV Assay
Constituent Samples
Non-Reactive Samples
Reactive Samples
HIV-1 and HCV Discriminatory Probes
Discriminated Samples
Non-Discriminated Samples
21
Results of NAT Screening in U.S.
Stramer, Glynn, Kleinman, Caglioti, Strong, Busch
. NEJM, 2004 Gandhi, Strong, Kleinman et al.
Blood102 (11)192A, 2003 Morb Mortal Wkly Rep
521160
Virus Dates Units tested NAT/Ab-
HCV 4-10/99 to 12/04 53.3 million 230 (1/230,000)
HIV 4/99-12/00 to 12/04 50.3 million 18 (1/3.1 million)
HBV 8/02 to 12/04 1.7 million 5 (1/330,000)
WNV 7/03 to 11/04 4.8 million 968 (1/5,000)
22
Correlation of routine HIV NAT screening with
supplemental HIV serological data 5,972 HIV-EIA
RR of 7.6 million donations at BSL, 04/99 - 07/03

Western Blot Result
Total
9/18 autologous donations, 6/9 from 3 donors.
1 false positive WB, f/u EIA R, WB(-), NAT(-).
1 w/ 1 p24 band-only 1 w/ /- p24,
p55, gp120 2 gp160 bands.
23
EIA signal/cutoff and WB band data for 18 BSL
donor samples that tested WB-pos / NAT-neg
17 infected donors with probable very low-level
viremia
1 donor with false positive WB
24

Yield of WNV NAT screening of 4,585,573 donations
from July-October, 2003 ARC ABC (95 of U.S.
collections)
944 confirmed viremic donors. - 770
detectable by MP-NAT - 174 ID-NAT-only (BSI
and ARC screened 36,269 donations)
25
Incremental WP Closure and Projected Yield (U.S.)
of ID over MP-NAT Screening
WP Closure (days) Yield per 107
HCV 3.2 2.5 (14,000,000)
HIV 3.9 2.5 (14,000,000)
HBV 12.3 14.5 (1690,000)
  • Assumes 20 member pools 20-fold differential
    sensitivity of ID-NAT and MP-NAT (e.g., 5 gEq/mL
    vs. 100 gEq/mL)
  • Does not include detection by ID-NAT of
    intermittent, low-level viremic episodes
    preceding ramp-up viremia

26
Risk (per unit) of transmission of major viruses
calculated using I x WP model
pre-NAT
MP-NAT
ID-NAT
HIV 1 1,200,000 1 1,800,000 1 2,800,000
HCV 1 230,000 1 1,600,000 1
2,300,000 HBV 1 220,000 1 260,000 1 500,000
27
Yield and Cost-Effectiveness of Enhanced Blood
Screening Procedures
Incremental CE of ID-NAT over MP-NAT 15
million / QALY
Jackson, Busch, Stramer, AuBuchon. Transfusion,
2003.
28
Application of donor NAT screening assays in HIV
research, diagnostic and public health settings
  • Pathogenesis and treatment studies (AIEDRP)
  • Mechanisms of viral clearance/control
  • Immune and viral evolution during primary
    infection
  • Response of early vs delayed therapy
  • Antiviral vs immune enhancement strategies
  • Vaccine trials
  • Establish incidence in enrolled populations
  • Discriminate vaccine response from breakthrough
    Tx
  • Precisely define infection dates for assessment
    of efficacy
  • PEP trial
  • Real-time NAT sensitivity and specificity

29
Yield of RNA and LS-EIA screening for enrollment
into AIEDRP primary HIV infection study (SF
Options Project 6/96 to 12/04)
40 EIA-, 31 WBind
71 of 486 cases of primary infection detected in
viremic pre-SC stages
30
Use of NAT Testing to Determine Time of Infection
in Two Phase III Trials of an HIV Vaccine
(VAX004/005)
  • 30 of 711 infections (1.8) detected by SC
    occurred in volunteers who were already viremic
    at baseline - would have been misclassified as
    vaccine failures
  • Based on 15-day (/-5) NAT/Ab- WP, baseline
    annualized HIV incidence estimated at 5.4
    (1.2-13.7, combined 95CI).
  • Additional 34 of infections had their date of
    infection changed based on NAT - important in the
    time-to-event analyses of efficacy
  • No vaccine effect on rate of detection of
    RNA/Ab- samples no evidence for accelerated or
    retarded seroconversion
About PowerShow.com