CS%203343:%20Analysis%20of%20Algorithms - PowerPoint PPT Presentation

View by Category
About This Presentation



CS 3343: Analysis of Algorithms Lecture 26: String Matching Algorithms – PowerPoint PPT presentation

Number of Views:70
Avg rating:3.0/5.0
Slides: 90
Provided by: Jianh157
Learn more at: http://www.cs.utsa.edu


Write a Comment
User Comments (0)
Transcript and Presenter's Notes

Title: CS%203343:%20Analysis%20of%20Algorithms

CS 3343 Analysis of Algorithms
  • Lecture 26 String Matching Algorithms

  • Text a longer string T
  • Pattern a shorter string P
  • Exact matching find all occurrence of P in T

length m
Length n
The naïve algorithm
Length m
Length n
Time complexity
  • Worst case O(mn)
  • Best case O(m)
  • aaaaaaaaaaaaaa vs. baaaaaaa
  • Average case?
  • Alphabet size k
  • Assume equal probability
  • How many chars do you need to compare before find
    a mismatch?
  • In average k / (k-1)
  • Therefore average-case complexity mk / (k-1)
  • For large alphabet, m
  • Not as bad as you thought, huh?

Real strings are not random
  • T aaaaaaaaaaaaaaaaaaaaaaaaa
  • P aaaab
  • Plus O(m) average case is still bad for long
  • Smarter algorithms
  • O(m n) in worst case
  • sub-linear in practice
  • how is this possible?

How to speedup?
  • Pre-processing T or P
  • Why pre-processing can save us time?
  • Uncovers the structure of T or P
  • Determines when we can skip ahead without missing
  • Determines when we can infer the result of
    character comparisons without actually doing them.

Cost for exact string matching
  • Total cost cost (preprocessing)
  • cost(comparison)
  • cost(output)

Hope gain gt overhead
String matching scenarios
  • One T and one P
  • Search a word in a document
  • One T and many P all at once
  • Search a set of words in a document
  • Spell checking
  • One fixed T, many P
  • Search a completed genome for a short sequence
  • Two (or many) Ts for common patterns
  • Would you preprocess P or T?
  • Always pre-process the shorter seq, or the one
    that is repeatedly used

Pattern pre-processing algs
  • Karp Rabin algorithm
  • Small alphabet and small pattern
  • Boyer Moore algorithm
  • The choice of most cases
  • Typically sub-linear time
  • Knuth-Morris-Pratt algorithm (KMP)
  • Aho-Corasick algorithm
  • The algorithm for the unix utility fgrep
  • Suffix tree
  • One of the most useful preprocessing techniques
  • Many applications

Algorithm KMP
  • Not the fastest
  • Best known
  • Good for real-time matching
  • i.e. text comes one char at a time
  • No memory of previous chars
  • Idea
  • Left-to-right comparison
  • Shift P more than one char whenever possible

Intuitive example 1
Naïve approach
  • Observation by reasoning on the pattern alone,
    we can determine that if a mismatch happened when
    comparing P8 with Ti, we can shift P by four
    chars, and compare P4 with Ti, without
    missing any possible matches.
  • Number of comparisons saved 6

Intuitive example 2
Naïve approach
  • Observation by reasoning on the pattern alone,
    we can determine that if a mismatch happened
    between P7 and Tj, we can shift P by six
    chars and compare Tj with P1 without missing
    any possible matches
  • Number of comparisons saved 7

KMP algorithm pre-processing
  • Key the reasoning is done without even knowing
    what string T is.
  • Only the location of mismatch in P must be known.

Pre-processing for any position i in P, find
P1..is longest proper suffix, t Pj..i,
such that t matches to a prefix of P, t, and the
next char of t is different from the next char of
t (i.e., y ? z) For each i, let sp(i) length(t)
KMP algorithm shift rule
Shift rule when a mismatch occurred between
Pi1 and Tk, shift P to the right by i
sp(i) chars and compare x with z. This shift
rule can be implicitly represented by creating a
failure link between y and z. Meaning when a
mismatch occurred between x on T and Pi1,
resume comparison between x and Psp(i)1.
Failure Link Example
  • P aataac

If a char in T fails to match at pos 6,
re-compare it with the char at pos 3 ( 2 1)
sp(i) 0 1 0 0 2 0
aa at
aat aac
Another example
  • P abababc

If a char in T fails to match at pos 7,
re-compare it with the char at pos 5 ( 4 1)
Sp(i) 0 0 0 0 0 4 0
ababa ababc
ab ab
abab abab
KMP Example using Failure Link
T aacaataaaaataaccttacta
  • Time complexity analysis
  • Each char in T may be compared up to n times. A
    lousy analysis gives O(mn) time.
  • More careful analysis number of comparisons can
    be broken to two phases
  • Comparison phase the first time a char in T is
    compared to P. Total is exactly m.
  • Shift phase. First comparisons made after a
    shift. Total is at most m.
  • Time complexity O(2m)

aataac .
aataac ..
aataac .
KMP algorithm using DFA (Deterministic Finite
  • P aataac

If a char in T fails to match at pos 6,
re-compare it with the char at pos 3
Failure link
If the next char in T is t after matching 5
chars, go to state 3
All other inputs goes to state 0.
DFA Example
T aacaataataataaccttacta
Each char in T will be examined exactly once.
Therefore, exactly m comparisons are made. But
it takes longer to do pre-processing, and needs
more space to store the FSA.
Difference between Failure Link and DFA
  • Failure link
  • Preprocessing time and space are O(n), regardless
    of alphabet size
  • Comparison time is at most 2m (at least m)
  • DFA
  • Preprocessing time and space are O(n ?)
  • May be a problem for very large alphabet size
  • For example, each char is a big integer
  • Chinese characters
  • Comparison time is always m.

The set matching problem
  • Find all occurrences of a set of patterns in T
  • First idea run KMP or BM for each P
  • O(km n)
  • k number of patterns
  • m length of text
  • n total length of patterns
  • Better idea combine all patterns together and
    search in one run

A simpler problem spell-checking
  • A dictionary contains five words
  • potato
  • poetry
  • pottery
  • science
  • school
  • Given a document, check if any word is (not) in
    the dictionary
  • Words in document are separated by special chars.
  • Relatively easy.

Keyword tree for spell checking
This version of the potato gun was inspired by
the Weird Science team out of Illinois
  • O(n) time to construct. n total length of
  • Search time O(m). m length of text
  • Common prefix only need to be compared once.
  • What if there is no space between words?

Aho-Corasick algorithm
  • Basis of the fgrep algorithm
  • Generalizing KMP
  • Using failure links
  • Example given the following 4 patterns
  • potato
  • tattoo
  • theater
  • other

Keyword tree
Keyword tree
Keyword tree
m length of text. n length of longest pattern
Keyword Tree with a failure link
Keyword Tree with a failure link
Keyword Tree with all failure links
Aho-Corasick algorithm
  • O(n) preprocessing, and O(mk) searching.
  • n total length of patterns.
  • m length of text
  • k is of occurrence.
  • Can create a DFA similar as in KMP.
  • Requires more space,
  • Preprocessing time depends on alphabet size
  • Search time is constant

Suffix Tree
  • All algorithms we talked about so far preprocess
  • Karp-Rabin small pattern, small alphabet
  • Boyer-Moore fastest in practice. O(m) worst
  • KMP O(m)
  • Aho-Corasick O(m)
  • In some cases we may prefer to pre-process T
  • Fixed T, varying P
  • Suffix tree basically a keyword tree of all

Suffix tree
  • T xabxac
  • Suffixes
  • xabxac
  • abxac
  • bxac
  • xac
  • ac
  • c

Naïve construction O(m2) using
Aho-Corasick. Smarter O(m). Very technical. big
constant factor Difference from a keyword tree
create an internal node only when there is a
Suffix tree implementation
  • Explicitly labeling seq end
  • T xabxa T xabxa






Suffix tree implementation
  • Implicitly labeling edges
  • T xabxa






Suffix links
  • Similar to failure link in a keyword tree
  • Only link internal nodes having branches

Suffix tree construction
1234567890 acatgacatt
Suffix tree construction
1234567890 acatgacatt
Suffix tree construction
1234567890 acatgacatt
Suffix tree construction
1234567890 acatgacatt
Suffix tree construction
1234567890 acatgacatt
Suffix tree construction
1234567890 acatgacatt

Suffix tree construction
1234567890 acatgacatt

Suffix tree construction
1234567890 acatgacatt

Suffix tree construction
1234567890 acatgacatt

Suffix tree construction
1234567890 acatgacatt


ST Application 1 pattern matching
  • Find all occurrence of Pxa in T
  • Find node v in the ST that matches to P
  • Traverse the subtree rooted at v to get the

T xabxac
  • O(m) to construct ST (large constant factor)
  • O(n) to find v linear to length of P instead of
  • O(k) to get all leaves, k is the number of
  • Asymptotic time is the same as KMP. ST wins if T
    is fixed. KMP wins otherwise.

ST Application 2 set matching
  • Find all occurrences of a set of patterns in T
  • Build a ST from T
  • Match each P to ST

T xabxac P xab
  • O(m) to construct ST (large constant factor)
  • O(n) to find v linear to total length of Ps
  • O(k) to get all leaves, k is the number of
  • Asymptotic time is the same as Aho-Corasick. ST
    wins if T fixed. AC wins if Ps are fixed.
    Otherwise depending on relative size.

ST application 3 repeats finding
  • Genome contains many repeated DNA sequences
  • Repeat sequence length Varies from 1 nucleotide
    to millions
  • Genes may have multiple copies (50 to 10,000)
  • Highly repetitive DNA in some non-coding regions
  • 6 to 10bp x 100,000 to 1,000,000 times
  • Problem find all repeats that are at least
    k-residues long and appear at least p times in
    the genome

Repeats finding
  • at least k-residues long and appear at least p
    times in the seq
  • Phase 1 top-down, count label lengths (L) from
    root to each node
  • Phase 2 bottom-up count of leaves descended
    from each internal node

For each node with L gt k, and N gt p, print all
O(m) to traverse tree
(L, N)
Maximal repeats finding
  • Right-maximal repeat
  • Si1..ik Sj1..jk,
  • but Sik1 ! Sjk1
  • Left-maximal repeat
  • Si1..ik Sj1..jk
  • But Si ! Sj
  • Maximal repeat
  • Si1..ik Sj1..jk
  • But Si ! Sj, and Sik1 ! Sjk1

  • cat
  • aca
  • acat

Maximal repeats finding
1234567890 acatgacatt

  • Find repeats with at least 3 bases and 2
  • right-maximal cat
  • Maximal acat
  • left-maximal aca

Maximal repeats finding
1234567890 acatgacatt

Left char
  • How to find maximal repeat?
  • A right-maximal repeats with different left chars

ST application 4 word enumeration
  • Find all k-mers that occur at least p times
  • Compute (L, N) for each node
  • L total label length from root to node
  • N leaves
  • Find nodes v with Lgtk, and L(parent)ltk, and Ngty
  • Traverse sub-tree rooted at v to get the locations

Lgtk, Ngtp
This can be used in many applications. For
example, to find words that appeared frequently
in a genome or a document
Joint Suffix Tree
  • Build a ST for many than two strings
  • Two strings S1 and S2
  • S S1 S2
  • Build a suffix tree for S in time O(S1 S2)
  • The separator will only appear in the edge ending
    in a leaf

  • S1 abcd
  • S2 abca
  • S abcdabca

a b c d

b c d a b c a



To Simplify
a b c d

b c d a b c a
b c d



  • We dont really need to do anything, since all
    edge labels were implicit.
  • The right hand side is more convenient to look at

Application of JST
Not subsequence
  • Longest common substring
  • For each internal node v, keep a bit vector B
  • B1 1 if a child of v is a suffix of S1
  • Find all internal nodes with B1 B2 1
  • Report one with the longest label
  • Can be extended to k sequences. Just use a longer
    bit vector.

b c d

Application of JST
  • Given K strings, find all k-mers that appear in
    at least d strings

Llt k
L gt k
B (1, 0, 1, 1)
cardinal(B) gt d
Many other applications
  • Reproduce the behavior of Aho-Corasick
  • Recognizing computer virus
  • A database of known computer viruses
  • Does a file contain virus?
  • DNA finger printing
  • A database of peoples DNA sequence
  • Given a short DNA, which person is it from?
  • Catch
  • Large constant factor for space requirement
  • Large constant factor for construction
  • Suffix array trade off time for space

  • One T, one P
  • Boyer-Moore is the choice
  • KMP works but not the best
  • One T, many P
  • Aho-Corasick
  • Suffix Tree
  • One fixed T, many varying P
  • Suffix tree
  • Two or more Ts
  • Suffix tree, joint suffix tree, suffix array

Alphabet independent
Alphabet dependent
Pattern pre-processing algs
  • Karp Rabin algorithm
  • Small alphabet and small pattern
  • Boyer Moore algorithm
  • The choice of most cases
  • Typically sub-linear time
  • Knuth-Morris-Pratt algorithm (KMP)
  • Aho-Corasick algorithm
  • The algorithm for the unix utility fgrep
  • Suffix tree
  • One of the most useful preprocessing techniques
  • Many applications

Karp Rabin Algorithm
  • Lets say we are dealing with binary numbers
  • Text 01010001011001010101001
  • Pattern 101100
  • Convert pattern to integer
  • 101100 25 23 22 44

Karp Rabin algorithm
  • Text 01010001011001010101001
  • Pattern 101100 44 decimal
  • 10111011001010101001
  • 25 0 23 22 21 46
  • 10111011001010101001
  • 46 2 64 1 29
  • 10111011001010101001
  • 29 2 - 0 1 59
  • 10111011001010101001
  • 59 2 - 64 0 54
  • 10111011001010101001
  • 54 2 - 64 0 44

Karp Rabin algorithm
  • What if the pattern is too long to fit into a
    single integer?
  • Pattern 101100. What if each word in our
    computer has only 4 bits?
  • Basic idea hashing. 44 13 5
  • 10111011001010101001
  • 46 ( 13 7)
  • 10111011001010101001
  • 46 2 64 1 29 ( 13 3)
  • 10111011001010101001
  • 29 2 - 0 1 59 ( 13 7)
  • 10111011001010101001
  • 59 2 - 64 0 54 ( 13 2)
  • 10111011001010101001
  • 54 2 - 64 0 44 ( 13 5)

T(mn) expected running time
Boyer Moore algorithm
  • Three ideas
  • Right-to-left comparison
  • Bad character rule
  • Good suffix rule

Boyer Moore algorithm
  • Right to left comparison

Skip some chars without missing any occurrence.
But how?
Bad character rule
  • 0 1
  • 12345678901234567
  • Txpbctbxabpqqaabpq
  • P tpabxab
  • What would you do now?

Bad character rule
  • 0 1
  • 12345678901234567
  • Txpbctbxabpqqaabpq
  • P tpabxab
  • P tpabxab

Bad character rule
  • 0 1
  • 123456789012345678
  • Txpbctbxabpqqaabpqz
  • P tpabxab
  • P tpabxab
  • P tpabxab

Basic bad character rule
char Right-most-position in P
a 6
b 7
p 2
t 1
x 5
Pre-processing O(n)
Basic bad character rule
T xpbctbxabpqqaabpqz
P tpabxab
When rightmost T(k) in P is left to i, shift
pattern P to align T(k) with the rightmost T(k)
in P
Shift 3 1 2
i 3
P tpabxab
char Right-most-position in P
a 6
b 7
p 2
t 1
x 5
Basic bad character rule
T xpbctbxabpqqaabpqz
P tpabxab
When T(k) is not in P, shift left end of P to
align with T(k1)
i 7
Shift 7 0 7
P tpabxab
char Right-most-position in P
a 6
b 7
p 2
t 1
x 5
Basic bad character rule
T xpbctbxabpqqaabpqz
P tpabxab
When rightmost T(k) in P is right to i, shift
pattern P one pos
i 5
5 6 lt 0. so shift 1
P tpabxab
char Right-most-position in P
a 6
b 7
p 2
t 1
x 5
Extended bad character rule
T xpbctbxabpqqaabpqz
P tpabxab
Find T(k) in P that is immediately left to i,
shift P to align T(k) with that position
i 5
5 3 2. so shift 2
P tpabxab
char Position in P
a 6, 3
b 7, 4
p 2
t 1
x 5
Preprocessing still O(n)
Extended bad character rule
  • Best possible m / n comparisons
  • Works better for large alphabet size
  • In some cases the extended bad character rule is
    sufficiently good
  • Worst-case O(mn)
  • What else can we do?

  • 0 1
  • 123456789012345678
  • Tprstabstubabvqxrst
  • P qcabdabdab
  • P qcabdabdab

According to extended bad character rule
(weak) good suffix rule
  • 0 1
  • 123456789012345678
  • Tprstabstubabvqxrst
  • P qcabdabdab
  • P qcabdabdab

(Weak) good suffix rule
Preprocessing For any suffix t of P, find the
rightmost copy of t, denoted by t. How to find
t efficiently?
(Strong) good suffix rule
  • 0 1
  • 123456789012345678
  • Tprstabstubabvqxrst
  • P qcabdabdab

(Strong) good suffix rule
  • 0 1
  • 123456789012345678
  • Tprstabstubabvqxrst
  • P qcabdabdab
  • P qcabdabdab

(Strong) good suffix rule
  • 0 1
  • 123456789012345678
  • Tprstabstubabvqxrst
  • P qcabdabdab
  • P qcabdabdab

(Strong) good suffix rule
In preprocessing For any suffix t of P, find
the rightmost copy of t, t, such that the char
left to t ? the char left to t
z ? y
  • Pre-processing can be done in linear time
  • If P in T, searching may take O(mn)
  • If P not in T, searching in worst-case is O(mn)

Example preprocessing
Bad char rule
Good suffix rule
char Positions in P
a 9, 6, 3
b 10, 7, 4
c 2
d 8,5
q 1
1 2 3 4 5 6 7 8 9 10
q c a b d a b d a b
0 0 0 0 0 0 0 2 0 0
dab cab
Where to shift depends on T
Does not depend on T
About PowerShow.com