Title: The Good, the bad and the ugly of Genetic Engineering
1The Good, the bad and the ugly of Genetic
Engineering
2- Genetic engineering is the human manipulation of
the DNA code of an organism in order to - Make transgenic organisms
- Clone an organism
- Perform Gene therapy
3Transgenic Organisms
- Organisms which express a gene from another
organism - Insert gene of interest into another organism,
receiving organism now makes the protein from
that gene
4Practical applications
- Plants with insecticide genes
- Cows with extra copies of growth hormones
- Insulin making bacteria
- And most importantly (haha)
5Practical applications?
- Cool Glow-in-the-dark Mice!!
6Going back to the insulin made by bacteria
- Diabetes dysfunctional Insulin gene no or low
amounts of insulin protein made - we can force bacteria to make insulin for us
7- Bacteria have circular pieces of DNA called
Plasmids - They can replicate, transcribe and translate any
genes on the plasmid
8- In plasmids there are also specific sequences
called restriction sites
restriction site
9- Restriction enzymes recognize the sites and cut
the DNA at that site
10- Each restriction enzyme recognizes and cuts a
different sequence
Examples Rest. Enzyme Rest. Site EcoRI GAATT
C Hind III AAGCTT BamH1 GGATCC
11- Restriction enzymes recognize the sites and cut
one strand of the DNA at that site
CACCTAGCTAG AATTCGACTAGCGAT
GTGGATCGATCTTAA GCTGATCGCTA
12- How many pieces do you get?
13- Single stranded ends are sticky
- Want to bind to complimentary bases
14- We can take advantage of this and insert any gene
we want into the breaks - Example The Insulin gene
15- What enzyme can we use to seal the gaps between
plasmid DNA and insulin DNA?
16Put plasmid back into bacteria (a process called
transformation) Bacteria will transcribe and
translate our insulin gene even though the
insulin protein doesnt do anything for a
bacterial cell. Then we can take out the insulin
protein and use it to treat diabetics.
17Same basic procedure, many different transgenics!
- Giving cows extra copies of the growth hormone
gene - Giving plants the gene that insects have to ward
off other enemy insects - Giving mice the gene that jelly fish use to
fluoresce
18Cloning
- Creating an organism that is genetically
identical to its parent.
19Cloning
- Mammals usually fuse info from two parents
(sexual reproduction) - Cloning takes all the chromosomes from 1 parent.
20(No Transcript)
21Zap to stimulate cell division
Implant embryo into surrogate sheep (sheep 3)
Inject nucleus into Egg
22Wait for Dolly to be born
Which sheep is Dolly identical to??
Why?
Which sheep have to be female?
23Snuppy
24Human Genome project
- What it did do Tell us each an every nucleotide
of the human genome (all 3.2 billion) - What it did not do Tell us what it all means!!!
25Human Genome project
- Now we have to break it down and determine
- - which pieces are genes
- - which pieces are junk
- - what info the genes hold.
26DNA finger printing
- Used to compare two peoples DNA
- Used in paternity cases
- Used for crime scene analysis
27DNA finger printing
28DNA finger printing
- Based on the idea that EVERYONEs DNA is unique,
like a fingerprint - BUT related individuals will have more
similarities
29How to do a DNA fingerprint
- Get a sample of DNA and digest it with
restriction enzymes
30How to do a DNA fingerprint
- If everyones DNA is unique, the enzyme will cut
each persons DNA differently - Example
- TCATGAATTCATTGCCGAATTCCGTGAATCCAGAATTCGGACTA
- TCATGAAGTCATTGCCGAATTCCGTGAATCCAGACTTCGGACTA
31How to do a DNA fingerprint
- Run cut up DNA on through electrophoresis
- Click here for animation
32How to do a DNA fingerprint
- Small pieces travel fast and move further down
the gel slab. - Large pieces move slower and stay closer to the
injection point.
33Gene Therapy
- Taking genetic testing one step further
- Gene therapy tries to FIX the genetic problem
34How do we fix a gene?
- Take a virus that naturally infects the type of
cells that are deffective.
35How do we fix a gene?
- Remove all the viruss DNA.
- Replace it with correct copy of deffective gene
36Possibilities?
- Cystic fibrosis
- Hemophilia
- Cancer