Biotechnology (Ch.20) - PowerPoint PPT Presentation

Loading...

PPT – Biotechnology (Ch.20) PowerPoint presentation | free to download - id: 6de020-NjM4Z



Loading


The Adobe Flash plugin is needed to view this content

Get the plugin now

View by Category
About This Presentation
Title:

Biotechnology (Ch.20)

Description:

Title: Biotechnology 2010edit Author: Kim Foglia/David Knuffke Last modified by: Ruth Gleicher Document presentation format: Custom Other titles: Gill Sans Lucida ... – PowerPoint PPT presentation

Number of Views:22
Avg rating:3.0/5.0
Date added: 31 October 2019
Slides: 49
Provided by: KimFo8
Learn more at: http://www.biogleich.com
Category:

less

Write a Comment
User Comments (0)
Transcript and Presenter's Notes

Title: Biotechnology (Ch.20)


1
Biotechnology(Ch.20)
2
A Brave New World
3
TACGCACATTTACGTACGCGGATGCCGCGACTATGATCACATAGACATGC
TGTCAGCTCTAGTAGACTAGCTGACTCGACTAGCATGATCGATCAGCTAC
ATGCTAGCACACYCGTACATCGATCCTGACATCGACCTGCTCGTACATGC
TACTAGCTACTGACTCATGATCCAGATCACTGAAACCCTAGATCGGGTAC
CTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATA
CTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGAC
TAGCTGACTGATCATGACTCTGATCCCGTAGATCGGGTACCTATTACAGT
ACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGA
TCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTG
ATCATGACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGATCATCC
GATCAGATCATGCTAGTACATCGATCGATACT
4
Biotechnology today
  • Genetic Engineering
  • manipulation of DNA
  • if you are going to engineer DNA genes
    organisms, then you need a set of tools to work
    with
  • this unit is a survey of those tools

5
Bacteria
  • Bacteria review
  • Unicellular prokaryotes
  • reproduce by binary fission
  • rapid growth
  • generation every 20 minutes
  • 108 (100 million) colony overnight!
  • dominant form of life on Earth
  • incredibly diverse

6
Bacterial genome
  • Single circular chromosome
  • haploid
  • naked DNA
  • no histone proteins
  • 4 million base pairs
  • 4300 genes
  • 1/1000 DNA in eukaryote

7
Plasmids
  • Small supplemental circles of DNA
  • 5000 - 20,000 base pairs
  • self-replicating
  • carry extra genes
  • 2-30 genes
  • genes for antibiotic resistance
  • can be exchanged between bacteria

8
How can plasmids help us?
  • A way to get genes into bacteria easily
  • insert new gene into plasmid
  • vector for gene delivery
  • bacteria now expresses new gene
  • bacteria make new protein


glue DNA
9
Biotechnology
  • Plasmids used to insert new genes into bacteria

10
How do we cut DNA?
  • Restriction enzymes
  • restriction endonucleases
  • discovered in 1960s
  • evolved in bacteria to cut up foreign DNA
  • restricted in the sequences they cut
  • protection against viruses other bacteria

?
11
What do you notice about these phrases?
radar racecar Madam Im Adam Able was I ere I saw
Elba a man, a plan, a canal, Panama Was it a bar
or a bat I saw? go hang a salami Im a lasagna hog
12
Restriction enzymes
  • Action of enzyme
  • cut DNA at specific sequences
  • restriction site
  • symmetrical palindrome
  • produces protruding ends
  • sticky ends
  • will bind to any complementary DNA
  • Many different enzymes
  • EcoRI, HindIII, BamHI, SmaI

?
CTGAATTCCG GACTTAAGGC
?
13
Discovery of restriction enzymes
1960s 1978
Werner Arber
Daniel Nathans
Hamilton O. Smith
Restriction enzymes are named for the organism
they come from EcoRI 1st restriction enzyme
found in E. coli
14
Restriction enzymes
  • Cut DNA at specific sites
  • leave sticky ends

restriction enzyme cut site
restriction enzyme cut site
15
Sticky ends
  • Cut other DNA with same enzymes
  • leave sticky ends on both
  • can glue DNA together at sticky ends

16
Sticky ends help glue genes together
gene you want
cut sites
cut sites
17
Why mix genes together?
  • Gene produces protein in different organism or
    different individual

human insulin gene in bacteria
bacteria
human insulin
18
The code is universal
  • Since all living organisms
  • use the same DNA
  • use the same code book
  • read their genes the same way

19
Copy ( Read) DNA
  • Transformation
  • insert recombinant plasmid into bacteria
  • grow recombinant bacteria in agar cultures
  • bacteria make lots of copies of plasmid
  • cloning the plasmid
  • production of many copies of inserted gene
  • production of new protein
  • transformed phenotype

20
Grow bacteriamake more
21
A Movie, Perhaps?
22
Uses of genetic engineering
  • Genetically modified organisms (GMO)
  • enabling plants to produce new proteins
  • Protect crops from insects BT corn
  • corn produces a bacterial toxin that kills corn
    borer (caterpillar pest of corn)
  • Extend growing season fishberries
  • strawberries with an anti-freezing gene from
    flounder
  • Improve quality of food golden rice
  • rice producing vitamin A improves nutritional
    value

23
Green with envy??
Jelly fish GFP
Transformed vertebrates
24
Discovery of GFP
1960s- 1970s 2008
Martin Chalfie
Osamu Shimomura
Roger Tsien
GFP and other fluorescent proteins can be used to
let us know when genes are on and off
25
Engineered plasmids
  • Building custom plasmids
  • restriction enzyme sites
  • antibiotic resistance genes as a selectable marker

EcoRI
BamHI
HindIII
restriction sites
plasmid
ori
ampresistance
26
Selection for plasmid uptake
  • Antibiotic becomes a selecting agent
  • only bacteria with the plasmid will grow on
    antibiotic (ampicillin) plate

a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
LB/amp plate
LB plate
27
Need to screen plasmids
  • Need to make sure bacteria have recombinant
    plasmid

restriction sites
all in LacZ gene
EcoRI
BamHI
HindIII
LacZ gene
plasmid
amp resistance
origin ofreplication
28
Screening for recombinant plasmid
29
Finding your gene of interest
  • DNA hybridization
  • find sequence of DNA using a labeled probe
  • short, single stranded DNA molecule
  • complementary to part of gene of interest
  • labeled with radioactive P32 or fluorescent dye
  • heat treat DNA in gel
  • unwinds (denatures) strands
  • wash gel with probe
  • probe hybridizes with denatured DNA

labeled probe
genomic DNA
C
T
A
G
T
C
A
T
C
30
DNA libraries
  • Cut up all of nuclear DNA from many cells of an
    organism
  • restriction enzyme
  • Clone all fragments into many plasmids at same
    time
  • shotgun cloning
  • Create a stored collection of DNA fragments
  • petri dish has a collection of all DNA fragments
    from the organism

31
Making a DNA library
gene of interest
32
DNA library
gene of interest
?
33
Find your gene in DNA library
  • Locate Gene of Interest
  • to find your gene you need some of genes
    sequence
  • if you know sequence of protein
  • can guess part of DNA sequence
  • back translate protein to DNA

?
34
Colony Blots
plate
film
plate filter
filter
35
Problems
  • Human Genome library
  • are there only genes in there?
  • nope! a lot of junk!
  • human genomic library has more junk than genes
    in it
  • Clean up the junk!
  • if you want to clone a human gene into
    bacteria, you cant have

36
How do you clean up the junk?
  • Dont start with DNA
  • Use mRNA
  • copy of the gene without the junk!
  • But in the end, you need DNA to clone into
    plasmid
  • How do you go from RNA ? DNA?
  • reverse transcriptase from RNA viruses
  • retroviruses

reverse transcriptase
37
cDNA (copy DNA) libraries
  • Collection of only the coding sequences of
    expressed genes
  • extract mRNA from cells
  • reverse transcriptase
  • RNA ? DNA
  • from retroviruses
  • clone into plasmid
  • Applications
  • need edited DNA for expression in bacteria
  • human insulin

38
Where do we go next.
  • When a gene is turned on, it creates a trait
  • want to know what gene is being expressed

39
Microarrays
  • Create a slide with a sample of each gene from
    the organism
  • each spot is one gene
  • Convert mRNA ? labeled cDNA

reverse transcriptase
40
Microarrays
  • Labeled cDNA hybridizes with DNA on slide
  • each yellow spot gene matched to mRNA
  • each yellow spot expressed gene

41
Application of Microarrays DNA Chip
  • Comparing treatments or conditions Measuring
    change in gene expression
  • sick vs. healthy cancer vs. normal cells
  • before vs. after treatment with drug
  • different stages in development
  • Color coding label each condition with different
    color
  • red gene expression in one sample
  • green gene expression in other sample
  • yellow gene expression in both samples
  • black no or low expression in both

42
Cut, Paste, Copy, Find
  • Word processing metaphor
  • cut
  • restriction enzymes
  • paste
  • ligase
  • copy
  • plasmids
  • bacterial transformation
  • is there an easier way??

43
EcoRI
BamHI
HindIII
restriction sites
plasmid
ori
ampresistance
44
  • 1. The principal problem with inserting an
    unmodified mammalian gene into the bacterial
    chromosome, and then getting that gene expressed,
    is that
  • prokaryotes use a different genetic code from
    that of eukaryotes.
  • bacteria translate polycistronic messages only.
  • bacteria cannot remove eukaryotic introns.
  • bacterial RNA polymerase cannot make RNA
    complementary to mammalian DNA.
  • bacterial DNA is not found in a membrane-enclosed
    nucleus and is therefore incompatible with
    mammalian DNA.

45
  • What is the purpose of a screening gene in a
    plasmid?
  • To enable tranformation.
  • To enable recovery of the plasmid from solution.
  • To enable identification of successful
    transformants.
  • To disable the spread of GE organisms outside of
    the laboratory
  • To make the engineered protein product.

46
  • 3. Which of the following is true of restriction
    enzymes?
  • They are capable of cutting DNA into fragments at
    specific points in the nucleotide sequence.
  • They form bonds between DNA fragments
  • They are used in cell recognition
  • They are a viral defense against infection by
    bacteria
  • They are found in fungi

47
  • 4. Which of the following contains DNA from
    different sources?
  • Restricted DNA
  • Recombinant DNA
  • Reanalyzed DNA
  • Reconstituated DNA
  • Resurrected DNA

48
  • Which of the following can serve as a vector for
    DNA?
  • I. Plasmids
  • II. Bacteriophages
  • III.Animal Cells
  • I only
  • II only
  • III only
  • I and II only
  • I, II and III
About PowerShow.com