Title: Development of a Diagnostic Test for Mutations in NPM1 Exon 12 in Cytogenetically Normal Acute Myeloid Leukaemia (AML) Patients
1Development of a Diagnostic Test for Mutations in
NPM1 Exon 12 in Cytogenetically Normal Acute
Myeloid Leukaemia (AML) Patients
- Alison Skinner
- Wessex Regional Genetics Laboratory
2NPM1 function
- Implicated in leukaemia as a translocation
partner for various oncogenes - Nucleolar phosphoprotein present predominantly in
the nucleolus - Regulates translational activity of p53 after
stress - Involved in centrosome duplication in the cell
cycle via cyclin E/CDK2 phosphorylation
3Effect of NPM1 mutations
- Gives prognostic information to the AML patients
with a normal karyotype (phenotypically variable) - Favourable prognosis in the absence of the FLT3
ITD - Better response to induction therapy and have a
better overall survival / longer event free
survival
4Acquired Mutations in NPM1
Wildtype GCTATTCAAGATCTCTGGCAGTGGAGGAAGTCTCTTTA
Agaaaatag -A--I--Q--D--L--W--Q--W--R--K--S--L---
--------
Mutation A GCTATTCAAGATCTCTGTCTGGCAGTGGAGGAAGTCT
CTTTAAgaaaatag -A--I--Q--D--L--C--L--A--V--E--E--
V--S--L--R--K---
Mutation B GCTATTCAAGATCTCTGCATGGCAGTGGAGGAAGTCT
CTTTAAgaaaatag -A--I--Q--D--L--C--M--A--V--E--E--
V--S--L--R--K---
Mutation D GCTATTCAAGATCTCTGCCTGGCAGTGGAGGAAGTCT
CTTTAAgaaaatag -A--I--Q--D--L--C--L--A--V--E--E--
V--S--L--R--K---
5Results of Direct Sequencing
- From the original 66 samples
- 41 had no visible mutation
- 1 had an intronic mutation of unknown
significance - 19 had a frameshift mutation
- 13 had mutation A
- 1 had mutation B
- 3 had mutation D
- 2 had novel mutations which still produced the
same NES
6Principles of Pyrosequencing
Image from www.pyrosequencing.com
7Designing the Pyrosequencing Assay
Wildtype
Mutation A
Mutation B
Mutation D
8Testing the Pyrosequencing Assay
Normal
Mutation A
Mutation B
Mutation D
9Further Analysis of the Pyrosequencing Results
10Examples of Results Using Analysis Spreadsheet
11Validation 1Retesting the Original Cohort
- All 66 samples that were tested by direct
sequencing were re-tested using the
pyrosequencing assay - 6 / 66 failed
- 1 sample failed for pyrosequencing but was normal
on direct sequencing - 1 sample failed for direct sequencing but had
mutation A on pyrosequencing, - All other failures had failed for both techniques
- Results of all other samples matched the results
for direct sequencing
12Validation 2Normal controls
- 3 / 96 failed
- There was no evidence of mutations in the normal
test plate - A quantification below 10 should be treated as
normal / with caution (depending on the quality
of the data)
13Validation 3Titration
- A titration of mutational load was set up
- Reliably sensitive to around 20 mutation
14Summary
- The test is sensitive and relatively
high-throughput - Identifies and quantifies the common NPM1 exon 12
mutations - Is able to identify other novel mutations in
the region - Helpful in identifying patients who have a
favourable prognosis
15Acknowledgements
- Dr Helen White NGRL (Wessex)
- Prof. Nick Cross WRGL
- Christine Waterman - WRGL