DNA TIPLEMESININ ADLI TIBBI UYGULAMALARI - PowerPoint PPT Presentation

Loading...

PPT – DNA TIPLEMESININ ADLI TIBBI UYGULAMALARI PowerPoint presentation | free to download - id: 585029-ZjEzY



Loading


The Adobe Flash plugin is needed to view this content

Get the plugin now

View by Category
About This Presentation
Title:

DNA TIPLEMESININ ADLI TIBBI UYGULAMALARI

Description:

FORENSIC DNA DNA T PLEMES N N ADL TIBB UYGULAMALARI Yrd.Do .Dr. Alper Tunga Akarsuba Ref: Dr.O uzhan Ekizo lu stanbul T p Fak ltesi Adli T p Ana ... – PowerPoint PPT presentation

Number of Views:146
Avg rating:3.0/5.0
Slides: 76
Provided by: OguzhanE
Learn more at: http://web.itu.edu.tr
Category:

less

Write a Comment
User Comments (0)
Transcript and Presenter's Notes

Title: DNA TIPLEMESININ ADLI TIBBI UYGULAMALARI


1
DNA TIPLEMESININ ADLI TIBBI UYGULAMALARI
FORENSIC DNA

Yrd.Doç.Dr. Alper Tunga Akarsubasi
Ref Dr.Oguzhan Ekizoglu Istanbul Tip Fakültesi
Adli Tip Ana Bilim Dali
2
Summary
  • What is DNA?
  • Where is DNA found in the body?
  • How does DNA differ among individuals?
  • Forensic DNA Analysis
  • DNA and Statistics

3
What is DNA?
  • What does DNA stand for?

Deoxyribose Nucleic Acid or Deoxyribonucleic
Acid
What does DNA do?
  • DNA contains genetic information.
  • DNA codes for the proteins our bodies make that
    are necessary for survival.

4
What is DNA?
  • DNA is a code for making proteins

AGC TAG CTT ATA CTC TAT CTC TTT
Amino Acid
Amino Acid
Amino Acid
Amino Acid
Amino Acid
Amino Acid
The order of amino acids determines what type of
protein is made.
5
What is DNA?
  • Some common proteins are
  • Hemoglobin - carries oxygen from lungs to cells
  • Insulin - regulates metabolism
  • Many types of enzymes - catalyze reactions in the
    body, such as the breakdown of sugar for energy

DNA also determines how much of these proteins
each cell makes.
6
What is DNA?
  • What does DNA look like?

Double Helix
Like a Twisted Ladder
7
What is DNA?
  • What does DNA look like?

Sugar Phosphate Backbone (Sides of Ladder)
Nitrogenous Base (Rungs of Ladder)
8
What is DNA?
  • The DNA ladder is made up of building blocks
    called nucleotides.

What is a nucleotide?
Adenine Cytosine Guanine Thymine
Phosphate Group
Base
Deoxyribose sugar
9
The 4 Bases
A Adenine
C Cytosine
T Thymine
G Guanine
10
The 4 Bases
A
C
T
G
11
The 4 Bases
The bases pair up to form the rungs of the ladder.
A pairs with T
G pairs with C
12
What is DNA?
  • DNA is written as the sequence of these bases

AAGTCGATCGATCATCGATCATACGT
  • Only one side of the ladder is written.
  • In humans, there are three billion
    (3,000,000,000) base pairs (letters) in the DNA
    within each cell.

13
What is DNA?
  • Among humans, most of the 3 billion bases in the
    DNA sequence are exactly the same.
  • Our Human DNA is 99.8 similar to each other, but
    the 0.2 difference is more than enough to
    distinguish us from one another.
  • Human DNA is even 98 similar to chimpanzees.
  • NO TWO PEOPLE HAVE IDENTICAL DNA
  • except identical twins

14
What is DNA?
  • Stupid Facts
  • If two different people started reciting their
    individual genetic code at a rate of one letter
    per second, it would take almost eight and a half
    minutes before they reached a difference.
  • If unwound and tied together, the strands of DNA
    in one cell would stretch almost six feet but
    would be only 50 trillionths of an inch wide.
  • If all the DNA in your body was put end to end,
    it would reach to the sun and back over 600 times
    (100 trillion times six feet divided by 92
    million miles).

15
Where is DNA?
  • DNA is found in the cells in our body.

Nucleus (Brain of the cell)
Mitochondria (more later)
16
Where is DNA?
  • All types of cells in our body contain a copy of
    the same DNA.

Some cells important to forensic science are
White Blood Cell
Cheek Cell
Sperm Cell
17
Where is DNA?
  • DNA in the nucleus is packaged into Chromosomes

18
Where is DNA?
Chromosomes come in pairs
(one from Mother) (one from Father)
There are 46 chromosomes in each cell.
(23 pairs)
19
Where is DNA?
  • What are sources of DNA at a crime scene?

DNA can be recovered from any substance that
contains cells.
  • Blood
  • Semen
  • Saliva
  • Tissue
  • Bone
  • Teeth
  • Hair
  • Maggot Crops

20
How does DNA differ among humans?
  • DNA is a sequence of 4 possible letters

G
A
C
T
Of the 3 billion letters, 99.8 of the sequence
in all humans is identical.
There are several ways the sequence can be
different.
21
How does DNA differ among individuals?
  • 1. One of the bases (letters) can be different.

Person 1 AGCTAGATCGTTATTCCGAG
Person 2 AGCTAGATCGTCATTCCGAG
22
How does DNA differ among individuals?
  • 2. Bases (letters) can be added or removed.

Person 1 AGCTAGATCGTTATTCCGAG
Person 2 AGCTAGATCGTATTCCGAG
Person 3 AGCTAGATCGTTTATTCCGAG
Person 4 AGCTCCGAG
23
How does DNA differ among individuals?
  • 2. Bases (letters) can be added or removed.

Person 1 AGCTAGATCGTTATTCCGAG
Person 2 AGCTAGATCGTATTCCGAG
Person 3 AGCTAGATCGTTTATTCCGAG
Person 4 AGCTCCGAG
24
How does DNA differ among individuals?
  • 3. Regions of DNA can be repeated a different
    of times

Person 1 ..GCCAGCTAGCTAGCTAGCTAGCTAGCTTTCAT..
25
How does DNA differ among individuals?
  • 3. Regions of DNA can be repeated a different
    of times

Person 1 ..GCCAGCTAGCTAGCTAGCTAGCTAGCTTTCAT..
1 2 3 4 5 6

Person 2 ..GCCAGCTAGCTAGCTAGCTAGCTTTCAT..
1 2 3 4 5
Person 3 ..GCCAGCTAGCTAGCTAGCTAGCTAGCTAGCTT..
1 2 3 4 5 6
7
26
Forensic DNA Analysis
  • Basic Steps in Analysis
  • Extraction
  • Separates DNA from sample
  • Amplification or PCR
  • Amplifies small portions of DNA (STR regions)
  • Separation
  • Separates amplified fragments according to size.

27
The Thermal Cycler
Amplifies DNA
28
(No Transcript)
29
FMBio
Separates Amplified DNA
30
Forensic DNA Analysis
  • Color image of gel

31
Forensic DNA Analysis
Gel Electrophoresis
Black and white image of STR gel.
Samples will have one or two bands at each loci.
32
ABI 310 Genetic Analyzer
Separates Amplified DNA
33
(No Transcript)
34
Forensic DNA Analysis
13 loci used in CODIS
35
DNA and Statistics
  • The final result is presented as a statistic.

Do not say The DNA in the bloodstain is John
Does DNA.
Do Say The chance that another person has this
DNA in the bloodstain is 1 in 300 billion.
36
DNA and Statistics
Where do the statistics come from?
First, the frequency of each allele is estimated
using data from a population data base.
Allele frequency from database
Locus D5S818
7 26
Alleles 7,9
9 11
37
DNA delillerinin toplanmasi ve saklanmasi
  • Kriminal arastirmalarin basarili sekilde
    sonuçlanmasi için fiziksel delil incelemesinin
    ilk dönemi çok önemlidir.
  • Yakin zamandaki olgular delil toplanmasi ve
    saklanmasi metodlari hakkindaki bilgilerin
    mahkemede titizlikle incelenmeye ve itiraz konusu
    olmaya devam edecegini açik bir sekilde
    desteklemektedir.

38
  • Gerçekten mahkemede DNA testinin kabul
    edilebilirligi için, kalan bir kaç itirazin çogu
    metodolojiyi ön plana almaktadir. Bunlar
  • Örnek toplanmasinin baslangicini
  • Örnegin saklanmasini
  • biyolojik delilin islenmesini

39
GENEL TEDBIRLER
  • Herhangi bir tipte biyolojik materyel alinirken,
    kan ve vücut sivilari için genel tedbirler
    izlenmelidir
  • Kanla tasinan patojenler fazlaca yaygin
    oldugundan, kaynagina bakilmaksizin tüm biyolojik
    örneklerin enfeksiyöz oldugunu farz etmek
    akillica olur.
  • Biyolojik delille direkt temastan kaçinin,
  • Biyolojik delili hazirlarken yada üzerinde
    islemler yaparken eldiven giyin,
  • Yemekten-içmekten sakinin

40
DNA KAYNAKLARI
  • Mitokondrial DNA analizleri disinda, DNA analizi
    için uygun deliller, nükleuslu hücreleri içeren
    biyolojik substanslarla sinirlidir.
  • Kan ve kan lekeleri
  • Semen ve seminal lekeler
  • Dokular ve organlar
  • Kemikler ve disler
  • Saç ve tirnaklar
  • Tükrük, idrar ve diger biyolojik sivilar

41
  • Göz yasi, ter, serum gibi diger biyolojik delil
    türleri nükleuslu hücrelerden mahrum oldugundan
    standard DNA analizleri için uygun degildir.
  • Gastrik sivi ve gaita lekeleri gibi diger
    materyellerden DNA izole edilmistir.
  • Bununla birlikte bu materyellerin olgu
    örneklerinden yeterli DNA elde etmek güçtür.
  • Hatta adi geçen örneklerden siklikla DNA
    tiplendirilebilmis olmasina ragmen çogu olguda,
    örnegin kalite ve/veya miktari DNA analizi için
    uygun degildir.

42
DNA profili elde edebilmeyi etkileyen faktörler
  • Örnegin miktari
  • Örnegin bozunmasi yani degradasyonu
  • Örnegin safligi

43
  • Toplama ve saklama yöntemleri bu 3 konu üzerinde
    ciddi etkiye sahiptir.
  • Amaçlanan test için yeterli DNAnin elde
    edilmesini saglayacak kadar çok miktarda materyel
    toplanmalidir.
  • Ortamdaki kir, yag ve diger pisliklerin
    alinmasindan kaçinmak esastir.( - PCR)
  • Örnekler toplandiktan sonra hemen adli tip
    laboratuvarina teslim edilmelidir.
  • Parçalar laboratuvara teslim edilene kadar soguk
    ve kuru ortamda tutulmalidir.

44
  • Genellikle biyolojik deliller 2 yoldan biri ile
    transfer edilir
  • Direkt deposit (döküntü) Örnek direkt temas
    eder
  • Sekonder (indirekt) transfer Bir araci
    yoluyla tasinabilir. Sekonder transferde orijinal
    kaynak ile (DNA delilinin donorü) hedef yüzey
    arasinda direkt temas yoktur.

45
DNA Delilinin Belgelenmesi
  • Suç alaninda delil
  • Delilin dokunmadan, hareket ettirmeden veya
    almadan önce fotografini çekin
  • Delili ve suç alanindaki nisbi lokalizasyonunu
    video-teype alin
  • Delilin durumunu ve yerini belgeleyin
  • Olay yerindeki diger objelerle delilin uzaysal
    iliskisini (3 boyutlu) not edin, krokisini çizin
  • Delil paketini isaretleyin, numaralayin ve
    mühürleyin

46
  • Adli Tip Laboratuvarinda Delil
  • Delil paketinin mühürünün durumunu, isaretini,
    numarasini not alin
  • Paketi örnek toplayicinin adi, laboratuvar olgu
    numarasi ve tarihi isaretleyin
  • Dogru örnegin teslim alindigindan emin olun.
  • Paket içeriginin fotograf ve/veya krokisini not
    edin
  • Herhangi bir örneklemeden önce materyel
    üzerindeki biyolojik delilin durumu ve
    yerlesimini belgeleyin.
  • Eger herhangi bir hazirlik testi yapilacaksa,
    testin natürünü ve sonuçlarini kayit edin.

47
  • Otopsi Salonunda Delil
  • Cesedi temizlemeden önce cesedin ve ek delillerin
    fotografini çekin
  • Delili not edin ve krokisini çizin
  • Temiz aletler kullanarak her delil parçasini
    sistematik olarak toplayin
  • Uygun toplama kaplarina her delil parçasini ayri
    ayri paketleyin
  • Toplama kabini isaretleyin ve toplanan örnegin
    miktarini not edin.
  • Örnegi uygun sekilde saklayin
  • Giysileri dikkatli alin

48
Kan ve Kan Lekeleri
  • Bir Bireyden Kan
  • Antikoagülan olarak EDTA içeren vakumlu bir tüp
    içine en az 5 ml. kan alinmalidir (mor kapakli).
  • Eger geleneksel serolojik ve/veya ilaç yada alkol
    analizleri yapilacaksa ek tüplere kan
    alinmalidir.
  • Her tüp tarih, saat, olgu adi, alim yeri, alinan
    miktar, olgu sayisi ve örnek sayisi ile
    isaretlenmelidir.
  • Kan örnekleri buzdolabina konmali ve mümkün
    oldugunca çabuk bir sekilde laboratuvara
    gönderilmelidir.
  • Eger serolojik testler yapilmasi düsünülüyorsa
    kanin dondurulmamasi gerektigine dikkat edin.

49
Suç alaninda sivi kan örnekleri
  • Steril igne veya disposable pipet kullanilarak
    alinmali ve temiz tercihen steril bir test tübüne
    nakledilmelidir.
  • Bir kan pihtisi temiz bir spatüla kullanilarak
    temiz bir test tüpüne aktarilabilir.
  • Temiz bir pamuklu kumas sivi kan yada kan
    pihtisinin emdirilmesi için kullanilabilir.
  • Kan paketlenmeden ve laboratuvara teslim
    edilmeden önce hava ile kurutulmalidir (fakat
    direkt günes isigi altinda degil).

50
Kar, Buz veya Su Içindeki Sivi Kan
  • Kar yada su içinde bulunan kan örnekleri daha
    fazla dilüsyondan kaçinmak için derhal
    alinmalidir
  • Bu örneklerin en konsantre kismi ve mümkün
    oldugunca fazla miktari temiz uygun bir kap içine
    alinmalidir (örnegin örnek fincani ile) ve
    dondurulmamalidir
  •   

51
Islak Kan Lekeli Giysiler
  • Islak kan lekeli giysiler temiz bir yüzey üzerine
    konmali ve hava ile kurumasina izin verilmelidir
    ( direk günes isigi, sac kurutma makinasi
    kullanmayin )
  • Kapali, hava geçirmez kutu yada plastik çantaya
    konmamalidir. ( degredasyon )
  • Giysiler ve lekeler kuruyunca temiz bir kagit ile
    paketlenir yada kagit kutuya konur

52
Büyük Ve Tasinamayan Objeler Üzerindeki Kuru
Kan Lekeleri
  • Kan lekesinin sekli fotograflanmali, belgelenmeli
    ve krokisi çizilmelidir
  • Kan lekesi temiz bir kagit üzerine kazinmalidir.
  • Alternatif olarak, her bir leke yüksek kalitede
    bir yapiskan band kullanilarak yüzeyden
    kaldirilabilir.
  • Eger band bulunamazsa, örnek, distile su ile
    nemlendirilmis numune kumas ile lekeli alan
    sürtülerek alinabilir.
  • Son olarak obje üzerine bir kaç kez pipetle küçük
    miktarda distile su damlatilirak, leke
    serbestlestirilir ve daha sonra örnek temiz bir
    test tüpü içine aktarilir.

53
Ceset üzerindeki kan lekeleri
  • Ceset üzerindeki kan lekeleri örnek alinmadan
    önce tamamen belgelenmelidir
  • Lekenin yeri, büyüklügü, miktari, sekli ve
    paterni not edilmelidir
  • Cesedin deri hücrelerinin alinmasini minimumuma
    indirmek için leke mümkün oldugu kadar nazikçe
    alinmalidir.
  • Tirnak altlarindaki kan lekeleri temiz bir
    kürdanla kazinmalidir. Tirnaklar temiz bir tirnak
    makasi ile nazikce kesilmeli ve alinmalidir

54
Semen ve Seminal Lekeler
  • Semen delilleri belgelenmelidir
  • Sivi semenin temiz bir test tüpüne
    aktarilmasinda, temiz bir igne yada disposable
    pipet kullanilmalidir
  • Daha önce anlatildigi gibi her biri
    isaretlenmelidir
  • Örnekler buzdolabinda tutulmali ve mümkün
    oldugunca çabuk laboratuvara teslim edilmelidir
  • Alternatif olarak sivi semen temiz bir pamuklu
    kumas parçasina yada swaba emdirilebilir. Daha
    sonra örnek kurutulur

55
Tasinabilir objeler üzerindeki seminal lekeler
  • Iç çamasirlari, giysiler, çarsaflar, yastiklar ve
    diger tasinabilir objeler üzerindeki seminal
    lekeler o haliyle alinir
  • Leke hala nemli ise hava ile kurumasina izin
    verilmelidir
  • Her örnek ayri ayri temiz kagit kutuya konarak
    paketlenmelidir
  • Örnekler mümkünse buzdolabinda saklanmali ve
    mümkün oldugu kadar çabuk laboratuvara teslim
    edilmelidir

56
Doku, Organ ve Kemik
  • Her delil örnegi not alinarak açiklanmali ve
    fotograf, kroki, videobandlarla belgelenmelidir
  • Her örnek temiz bir çift forsepsle toplanmali
  • Her örnek temiz ve fiksatif içermeyen bir kaba
    yerlestirilmelidir

57
  • Sivi Örnekler
  • Sivi idrar yada tükrük mümkün oldugunca çabuk
    temiz steril bir kaba (plastik yada cam örnek
    kabi) alinmalidir
  • Saçlar
  • Saç deliller temiz bir çift forceps ile
    toplanmalidir
  • Her örnek yada saç grubu ayri olarak
    paketlenmelidir
  • Saç kökü dokusuna zarar vermemek için toplama
    sirasinda dikkatli olmak gereklidir
  • Eger saçlar nemli vücut sivilarina bulasmissa,
    gönderilmeden önce hava ile tamamen
    kurutulmalidir

58
Ceza Muhakemesinde Beden Muayenesi, Genetik
Incelemeler ve Fizik Kimligin Tespiti Hakkinda
Yönetmelik 
  • Madde 1- Bu Yönetmelik bir suça iliskin iz,
    eser, emare ve delillerin elde edilmesi ayrica,
    maddî gerçegin ortaya çikartilmasi bakimindan
    süpheli, sanik, magdur ve diger kisilerin beden
    muayenelerinin yapilmasi, tibbî incelemelerde
    bulunmak üzere vücuttan, kan, cinsel salgi, saç,
    tükürük, tirnak gibi örneklerin alinmasi,
    moleküler genetik incelemeler ile süpheli ve
    sanigin kimliginin teshisi için gerekli fizikî
    özelliklerin tespitine iliskin usul ve esaslari
    düzenlemektir.
  • Dayanak
  • Madde 2- Bu Yönetmelik, 04/12/2004 tarihli ve
    5271 sayili Ceza Muhakemesi Kanununun 82 nci
    maddesine dayanilarak hazirlanmistir.

59
  • Süpheli veya sanigin beden muayenesi
  • Madde 4- Bir suça iliskin delil elde etmek için,
    süpheli veya sanigin bedeninin tibbî muayenesine
    Cumhuriyet savcisi veya magdurun istemiyle ya da
    resen hâkim veya mahkeme tarafindan karar
    verilebilir.
  • Süpheli veya sanigin beden muayenesi ancak hekim
    tarafindan yapilir.
  • Tibbî muayenenin yapilabilmesi için müdahalenin,
    kisinin sagligina açikça ve öngörülebilir zarar
    verme tehlikesinin bulunmamasi gerekir.
  • Üst siniri iki yildan daha az hapis cezasini
    gerektiren suçlarda kisi üzerinde beden muayenesi
    yapilamaz

60
  • Süpheli veya sanigin vücudundan örnek alinmasi
  • Madde 5-  Bir suça iliskin delil elde etmek için,
    süpheli veya sanigin vücudundan kan veya cinsel
    salgi gibi örnekler alinmasina, Cumhuriyet
    savcisi veya magdurun istemiyle ya da resen
    hâkim veya mahkeme tarafindan karar verilebilir.
  • Süpheli veya sanigin vücudundan saç, tükürük ve
    tirnak gibi örnekler alinabilmesine Cumhuriyet
    savcisi da karar verebilir. Cumhuriyet savcisinin
    karari, yirmidört saat içinde hâkim veya
    mahkemenin onayina sunulur. Hâkim veya mahkeme,
    yirmidört saat içinde kararini verir.
    Onaylanmayan kararlar hükümsüz kalir ve elde
    edilen deliller kullanilamaz. Bu örnekler
    Cumhuriyet savcisinin huzurunda ve uygun görecegi
    usullerle derhâl yok edilerek bu husus tutanaga
    geçirilir.
  • Bu müdahaleler ancak hekim tarafindan veya hekim
    gözetiminde saglik meslegi mensubu diger bir kisi
    tarafindan yapilabilir.
  • Vücuttan örnekler alinabilmesi için müdahalenin,
    kisinin sagligina açikça ve öngörülebilir zarar
    verme tehlikesinin bulunmamasi gerekir.
  • Tibbî müdahaleler, hekimlik sanatinin ve tip
    biliminin kabul ettigi yöntem ve araçlarla
    yapilir.
  • Üst siniri iki yildan daha az hapis cezasini
    gerektiren suçlarda kisiden kan, saç, tükürük,
    tirnak, cinsel salgi gibi örnekler alinamaz

61
  • Diger kisilerin beden muayenesi
  • Madde 6
  • Diger kisilerin vücudundan örnek alinmasi
  • Madde 7
  • Soy baginin arastirilmasi
  • Madde 8 Çocugun soy baginin arastirilmasina
    gerek duyulmasi hâlinde, bu arastirmanin
    yapilabilmesi için, bu Yönetmeligin 6 ve 7 nci
    maddeleri hükümlerine göre karar alinmasi
    gereklidir

62
  • Tanikliktan çekinme sebeplerinin varligi
  • Madde 9- Tanikliktan çekinme sebepleri ile
    muayeneden veya bedenden örnek alinmasindan
    kaçinilabilir.
  • Tanikliktan çekinme sebeplerinin belirlenmesi
    hususunda Ceza Muhakemesi Kanununun ilgili
    hükümleri uygulanir.
  • Çocuk ve akil hastasinin çekinmesi konusunda
    kanunî temsilcisi karar verir. Çocuk veya akil
    hastasinin, tanikligin hukukî anlam ve
    sonuçlarini algilayabilecek durumda olmasi
    hâlinde, görüsü de alinir.
  • Kanunî temsilci de süpheli veya sanik ise bu
    konuda hâkim tarafindan karar verilir. Ancak, bu
    hâlde elde edilen deliller davanin ileri
    asamalarinda süpheli veya sanik olmayan kanunî
    temsilcinin izni olmadikça kullanilamaz.

63
  • Kadinin muayenesi
  • Madde 10- Kadinin muayenesi, istemi hâlinde ve 
    olanaklar elverdiginde bir kadin hekim tarafindan
    yapilir.
  • Muayene edilecek kadinin talebine ragmen bir
    kadin hekimin bulunmasina olanaklarin elvermedigi
    durumlarda muayene sirasinda hekim ile birlikte
    bir baska kadin saglik meslegi personelinin
    bulundurulmasina özen gösterilir

64
  • Moleküler genetik incelemeler
  • Madde 11- Bu Yönetmelikte öngörülen islemlerle
    elde edilen örnekler üzerinde, soy baginin veya
    elde edilen bulgunun süpheli veya saniga ya da
    magdura ait olup olmadiginin tespiti için zorunlu
    olmasi hâlinde moleküler genetik incelemeler
    yapilabilir. Alinan örnekler üzerinde bu amaçlar
    disinda tespitler yapilmasina yönelik incelemeler
    yasaktir.
  • Birinci fikra uyarinca yapilabilen incelemeler,
    bulunan ve kime ait oldugu belli olmayan beden
    parçalari üzerinde de yapilabilir. Birinci
    fikranin ikinci cümlesi, bu hâlde de uygulanir.

65
  • Bilirkisi incelemesi
  • Madde 12- Bu Yönetmeligin 11 inci maddesi
    hükümleri uyarinca moleküler genetik incelemeler
    yapilmasina sadece hâkim karar verebilir. Kararda
    inceleme ile görevlendirilen bilirkisi de
    gösterilir.
  • Bilirkisi gerçek ya da tüzel kisi olabilir.
  • Yapilacak incelemeler için resmen atanan veya
    bilirkisilikle yükümlü olan ya da sorusturma veya
    kovusturmayi yürüten makama mensup olmayan veya
    bu makamin sorusturma veya kovusturmayi yürüten
    dairesinden teskilât yapisi itibariyla ve
    objektif olarak ayri bir birimine mensup olan
    görevliler, bilirkisi olarak görevlendirilebilirle
    r. Bu kisiler, teknik ve teskilât bakimindan
    uygun tedbirlerle yasak moleküler genetik
    incelemelerin yapilmasini ve yetkisiz üçüncü
    kisilerin bilgi edinmesini önlemekle
    yükümlüdürler. Incelenecek bulgu, bilirkisiye
    ilgilinin adi ve soyadi, adresi, dogum tarihi
    bildirilmeksizin verilir.

66
  • Bilirkisiye gönderilen örneklerle ilgili olarak
    hâkimlikler, mahkemeler ve Cumhuriyet
    bassavciliklari gizliligi saglamak ve karisikliga
    yer vermemek için gerekli her türlü tedbiri
    alirlar. Bu amaçla güvenli ve gizli bir kayit
    sistemi belirlenir. Bu kayit sisteminde
    bedeninden örnek alinan kisinin adi, soyadi,
    adresi ve dogum tarihine karsilik gelmek üzere
    bir kod sistemi uygulanir.
  • Üçüncü fikranin uygulanmasi açisindan, teskilât
    yapisi itibariyla Üniversiteler, Emniyet Genel
    Müdürlügü, Jandarma Genel Komutanligi ve Adlî Tip
    Kurumu objektif olarak ayri birimler sayilirlar

67
  • Moleküler genetik inceleme sonuçlarinin gizliligi
  • Madde 13- Bu Yönetmelik hükümlerine göre alinan
    örnekler üzerinde yapilan inceleme sonuçlari,
    kisisel veri niteliginde olup, baska bir amaçla
    kullanilamaz dosya içerigini ögrenme yetkisine
    sahip bulunan kisiler tarafindan bir baskasina
    verilemez.
  • Tüm bu bilgiler, kovusturmaya yer olmadigi
    kararina itiraz süresinin dolmasi, itirazin reddi
    veya hükmün kesinlesmesi hâllerinde en geç on gün
    içinde Cumhuriyet savcisinin huzurunda ve uygun
    görecegi usullerle yok edilir ve bu husus
    dosyasinda muhafaza edilmek üzere tutanaga
    geçirilir. Olay yerinden elde edilen diger
    delillere iliskin hükümler saklidir.
  • Bilirkisi tarafindan yapilan analizler sonucu
    elde edilen bulgular ilgili makama gönderilir
    bulgular üzerinden moleküler genetik analizler
    için izole edilen DNA örnekleri bilirkisi
    tarafindan rapor hazirlandiktan sonra imha edilir
    ve bu husus raporda açikça belirtilir.
  • Moleküler genetik incelemelerin özel kalitsal
    karakterler hakkindaki açiklamayi içermedigi
    bilinen kromozom bölgesi ile sinirli kalmasina
    özen gösterilir.

68
  • Fizik kimligin tespiti
  • Madde 14- Üst siniri iki yil veya daha fazla
    hapis cezasini gerektiren bir suçtan dolayi
    süpheli veya sanigin, kimliginin teshisi için
    gerekli olmasi hâlinde, Cumhuriyet savcisi veya
    hâkim karariyla  fotografi, iris görüntüsü,
    beden ölçüleri, dis izi, parmak ve ayak izi, 
    bedeninde yer almis olup teshisini
    kolaylastiracak eskâl bilgileri, avuç, kulak,
    dudak gibi organlarin biraktigi kimlik tespitine
    yarayabilecek vücut izleri ile sesi ve
    görüntüleri, fizik kimligin tespitinde kullanilan
    diger teknik yöntemler ile kayda alinarak,
    sorusturma ve kovusturma islemlerine iliskin
    dosyaya konulur.  
  • Fizik kimligin tespitinde, öncelikli olarak elin
    iç yüzeyindeki derinin özel kivrimli sekilleri
    olan parmak ve avuç izleri, fotografi ve eskâl
    bilgileri kullanilir. Bu islemler olay yeri
    inceleme ve kimlik tespit konusunda özel egitim
    almis uzman kolluk mensubu tarafindan yapilir.
  • Fizik kimligin tespiti açisindan, kisinin
    agzindaki dislerin incelenmesi ve dis izlerinin
    alinmasi dis hekimi tarafindan yapilir

69
  • Verilerin imhasi
  • Madde 15- Kovusturmaya yer olmadigi veya beraat
    karari verilmesi hâlinde bu Yönetmeligin 14 üncü
    maddesi hükümleri uyarinca elde edilen veriler,
    Cumhuriyet savcisinin huzurunda ve uygun görecegi
    usullerle derhâl yok edilir ve bu husus tutanaga
    geçirilir.
  • Verilerin korunmasi
  • Madde 16- Mahkûmiyet karari verilmesi hâlinde bu
    Yönetmeligin 14 üncü maddesinin bir ve ikinci
    fikralari uyarinca elde edilen veriler kolluk
    tarafindan, üçüncü fikrasinda belirtilen dis
    izleri ise bu islemi yapan saglik kurulusu
    tarafindan arsivlenir

70
  • Ilgilinin rizasi
  • Madde 17-  Mevzuatta aranan tüm kosullarin
    gerçeklesmis olmasina ve süpheli, sanik veya
    diger kisilerin bu konuda aydinlatilmis
    olmalarina ragmen muayene yapilmasina ya da örnek
    alinmasina riza vermemeleri hâlinde, kararin
    infazi için ilgilinin muayenesini veya vücudundan
    örnek alinmasini saglamak üzere ilgili Cumhuriyet
    bassavciliginca gerekli önlemler alinir.
  • Bir suçun aydinlatilmasini saglamak amaciyla,
    süpheli, sanik ve diger kisilerin kendiliginden
    basvurarak riza göstermeleri hâlinde, sorusturma
    evresinde Cumhuriyet savcisinin istemi,
    kovusturma asamasinda ise hâkim veya mahkeme
    karariyla tibbî muayeneleri yapilabilir ya da
    vücutlarindan örnek alinabilir

71
  • Tedavi amaçli müdahaleler
  • Madde 18- Saglik mevzuati ve taraf olunan
    uluslararasi sözlesmeler uyarinca hekim
    tarafindan yapilmasi gereken tedavi amaçli tibbî
    muayene ve müdahaleler için Cumhuriyet savcisi ya
    da hâkim karari aranmaz.
  • Gecikmesinde sakinca bulunan hâller
  • Madde 19
  • Raporlarin düzenlenmesi
  • Madde 20  Hekim raporlari üç nüsha hâlinde
    düzenlenir. Raporu düzenleyen saglik kurulusunca 
    iki nüshasi kapali ve mühürlü zarf içerisinde
    ilgili Cumhuriyet bassavciligina, hâkimlige veya
    mahkemeye en seri sekilde  iletilir. Raporun bir
    nüshasi raporu düzenleyen saglik kurulusunda
    kalir.

72
  • Güvenlik önlemleri
  • Madde 21- Muayene edilmesi veya vücudundan örnek
    alinmasi amaciyla sevk edilen kisi disinda baska
    bir kisinin muayene edilmemesi ya da vücudundan
    örnek alinmamasi için Cumhuriyet
    bassavciliklarinca gerekli önlemler alinir.
  • Hekim veya diger saglik meslegi mensuplarinca,
    sevk edilen kisinin kimligi konusunda süpheye
    düsülmesi hâlinde durum derhâl Cumhuriyet
    bassavciligina bildirilir.
  • Alinan, muhafaza edilen, nakledilen ve incelenen
    örneklerin degistirilmemesi ve dis kosullardan
    etkilenip bozulmamasi için Cumhuriyet
    bassavciligi, kolluk, saglik kurulusu ve
    bilirkisi tarafindan gerekli tedbirlere
    basvurulur.

73
  • Verilerle ilgili islemler
  • Madde 22
  • Diger Islemler
  • Madde 23- Kisinin vücut yüzeyinde bulunan atis
    artigi gibi biyolojik olmayan örnekler,
    elbiseleri ve diger esyalari üzerinde bulunan
    örnekler ile vücut yüzeyinden baskasina ait
    oldugu açikça belli olan kil, tüy, lif gibi
    örnekler olay yeri inceleme uzmanlari tarafindan
    alinabilir.
  • Itiraz
  • Madde 24
  • Yürürlük
  • Madde 25
  • Yürütme
  • Madde 26

74
  • Tesekkürler

75
Fundamental Approaches
About PowerShow.com