Gene regulation and expression in plants- overview - PowerPoint PPT Presentation

Loading...

PPT – Gene regulation and expression in plants- overview PowerPoint presentation | free to download - id: 47ae8b-OTBmN



Loading


The Adobe Flash plugin is needed to view this content

Get the plugin now

View by Category
About This Presentation
Title:

Gene regulation and expression in plants- overview

Description:

Gene Regulation Gene regulation and expression in plants- overview Plant development and the environment Signal transduction- a general view Regulation of plant genes ... – PowerPoint PPT presentation

Number of Views:404
Avg rating:3.0/5.0
Slides: 71
Provided by: DEPARTMENT522
Category:

less

Write a Comment
User Comments (0)
Transcript and Presenter's Notes

Title: Gene regulation and expression in plants- overview


1
Gene Regulation
  • Gene regulation and expression in plants-
    overview
  • Plant development and the environment
  • Signal transduction- a general view
  • Regulation of plant genes and transcription
    factors
  • Light regulation in plants and Phytochrome
  • Light regulated elements
  • Plant growth regulators
  • Abscisic acid (ABA) and ABA-responsive genes

2
Gene Regulation
  • Regulation of gene expression in plants is
    essentially the same as in animals.
  • But, the hormones (plant growth regulators) in
    plants are very different. Also, plant
    development is profoundly influenced by
    environment.
  • Therefore, this lecture deals with gene
    regulation in response to
  • 1/ light,
  • 2/ plant growth regulators using absisic acid as
    an example

3
Plants and gene expression
  • Plants undergo chronological changes in
    morphology and therefore require developmentally
    regulated gene expression.
  • Plants have organs (not so many as higher
    animals) and therefore require organ specific
    gene expression.
  • Plants cannot move their entire body and must
    therefore respond to changes in the environment.
    They therefore require environmentally regulated
    gene expression.

4
Plant Development and the Environment
ENVIRONMENTAL STIMULI Light- intensity,
direction, duration Gravity Touch Temperature Wate
r Pathogen infection
COMPONENTS OF ENVIROMENTALLY REGULATED
BEHAVOIUR Perception Signal Transduction Response
RESPONSES TO THE ENVIRONMENT Nastic
Responses Tropic Responses Morphogenic
Responses Localised Cellular Responses Systemic
Cellular Responses
5
Plant Development and the Environment
  • Nastic Responses- (greek nastos pressed
    closed) typically a non-growth response that is
    not orientated with regard to the stimulus e.g.
    closing flower at night, stomatal closure.
  • Tropic Responses- (greek trope turn)typically
    a growth response that is orientated with regard
    to the stimulus e.g. gravitropism, phototropism.
  • Morphogenic Responses- a response which results
    in fundamental change in plant metabolism or form
    e.g. photomorphogenesis.
  • Localised Cellular Responses- small scale changes
    in cell metabolism e.g. hypersensitive response
    to pathogens.
  • Systemic Cellular Responses- whole plant changes
    in cell metabolism e.g. systematic acquired
    resistance

6
Signal Transduction Components
  • Stimulus
  • Hormones, physical environment, pathogens
  • Receptor
  • On the plasmamembrane, or internal
  • Secondary messengers
  • Ca2, G-proteins, Inositol Phosphate
  • Effector molecules
  • Protein kinases or phosphatases
  • Transcription factors
  • Response
  • Stomatal closure
  • Change in growth direction

7
Signal transduction Simplified model
STIMULUS
Plasma membrane
R
G-prot
Ca2
Phos
Ca2
Kin
Nuclear membrane
R
TF
DNA
8
Regulation of a Plant Gene
I
I
-1000 -74 bp -54 to -50bp
to -16 bp
Promoter Transcribed untranslated regions Coding
sequence (exons) Introns
I
9
Regulation of transcription Transcription
factors Bind to RNA polymerase and effect the
rate of transcription
Coding region
TATA box
Transcription initiation
RNA Polymerase
Transcription factors
10
Light in Plants
We see visible light (350-700 nm) Plants sense
Ultra violet (280) to Infrared (800) Examples
Seed germination - inhibited by light Stem
elongation- inhibited by light Shade avoidance-
mediated by far-red light There are probably 4
photoreceptors in plants We will deal with the
best understood PHYTOCHROMES
11
The structure of Phytochrome
A dimer of a 1200 amino acid protein with several
domains and 2 molecules of a chromophore.
Chromophore
660 nm 730 nm
Pr Pfr
Binds to membrane
12
Signal Transduction of Phytochrome
Membrane
Pfr
Ga
G protein a subunit
Pr
Cyclic guanidine monophosphate
Guanylate cyclase
cGMP
Ca2/CaM
Calmodulin
CAB, PS II ATPase Rubisco
FNR PS I Cyt b/f
CHS
Anthocyanin synthesis
Chloroplast biogenesis
13
Light-Regulated Elements (LREs) e.g. the
promotor of chalcone synthase-first enzyme in
anthocyanin synthesis
Promoter has 4 sequence motifs which participate
in light regulation. If unit 1 is placed upstream
of any transgene, it becomes light regulated.
14
Light-Regulated Elements (LREs)
  • There are at least 100 light responsive genes
    (e.g. photosynthesis)
  • There are many cis-acting, light responsive
    regulatory elements
  • 7 or 8 types have been identified of which the
    two for CHS are examples
  • No light regulated gene has just 1.
  • Different elements in different combinations and
    contexts control the level of transcription
  • Trans-acting elements and post-transcriptional
    modifications are also involved.

15
Plant growth regulators and their impact on plant
development
Hormone Response (not a complete
list) Auxin Abscission suppression apical
dominance cell elongation fruit ripening
tropism xylem differentiation Cytokinin Bud
activation cell division fruit and embryo
development prevents leaf senescence Gibberel
lin Stem elongation pollen tube growth
dormancy breaking Abscisic Acid Initiation of
dormancy response to stress stomatal
closure Ethylene Fruit ripening and abscission
initiation of root hairs wounding responses
16
Abscisic Acid (ABA) responsive genes ABA is
involved in two distinct processes 1/ Control of
seed development and germination 2/ Stress
responses of the mature plant DROUGHT IN
SALINITY A suite of stress response genes are
turned on COLD
The signal transduction pathway is still poorly
understood but certain common regulatory elements
have been found in the promoters of ABA
responsive genes.
17
Promoter studies of ABA responsive elements in
Barley
Section of the upstream region of a barley ABA
responsive gene CCGGCTGCCCGCCACGTACACGCCAAGCACCCGG
TGCCATTGCCACCGG -104 -56
(Shen and Ho 1997)
Reporter gene (GUS)
Minimal promoter
18
ABA responsive elements GCCACGTACANNNNNNNNNNNNNN
NNNNNNTGCCACCGG-------- ACGCGTCCTCCCTACGTGGC----
-------------------------------
19
(No Transcript)
20
Plant Disease Resistance
  • Importance of pests and pathogens
  • Complete v.s. partial resistance
  • Gene for gene theory
  • Cloned resistance genes
  • A model of Xa21, blight resistance gene
  • The arms race explained

21
Where does our food go? The proportion of
total production lost due to biotic constraints
1967
Weeds 10
Pests 11
Pathogens 12
Product 67
We are engaged in a continuous struggle to
control weeds, pests and diseases
22
Some important pest and pathogens of
plants Pathogens Fungi Bacteria Viruses Pests
Nematodes Insects Vertebrates (not fish!)
23
Complete and Partial Resistance There are two
fundamentally different mechanisms of disease
resistance.
Partial Resistance horizontal resistance Not
specific- confers resistance to a range of
pathogens QUANTITATIVE
Complete resistance vertical resistance Highly
specific (race specific) Involves evolutionary
genetic interaction (arms race) between host and
one species of pathogen. QUALITATIVE
24
Complete and Partial Resistance There are two
fundamentally different mechanisms of disease
resistance.
25
Gene-for-Gene theory of Complete Resistance
If the pathogen has an Avirulence gene and the
host a Resistance gene, then there is no infection
26
Gene-for-Gene theory of Complete Resistance
The Avirulence gene codes for an Elicitor
molecule or protein controlling the synthesis of
an elicitor.
The Resistance gene codes for a receptor molecule
which recognises the Elicitor.
A plant with the Resistance gene can detect the
pathogen with the Avirulence gene.
Once the pathogen has been detected, the plant
responds to destroy the pathogen.
Both the Resistance gene and the Avirulence gene
are dominant
27
Gene-for-Gene theory of Complete Resistance
What is an elicitor? It is a molecule which
induces any plant defence response. It can be a
polypeptide coded for by the pathogen avirulence
gene, a cell wall breakdown product or
low-molecular weight metabolites. Not all
elicitors are associated with gene-for-gene
interactions.
What do the Avirulence genes (avr genes) code
for? They are very diverse! In bacteria, they
seem to code for cytoplasmic enzymes involved in
the synthesis of secreted elicitor. In fungi,
some code for secreted proteins, some for fungal
toxins.
28
ELICITORS Elicitors are proteins made by the
pathogen avirulence genes, or the products of
those proteins Elicitors of Viruses Coat
proteins, replicases, transport
proteins Elicitors of Bacteria 40 cloned, 18-100
kDa in size Elicitors of Fungi Several now
cloned- diverse and many unknown
function Elicitors of Nematodes Unknown number
and function
29
Gene-for-Gene theory of Complete Resistance
What does a resistance gene code for? The
receptor for the specific elicitor associated
with the interacting avr gene
30
Protein structure of cloned resistance genes
31
Model for the action of Xa21 (rice blight
resistance gene)
Leucine-rich receptor
Transmembrane domain
Kinase
Membrane
Elicitor
Signal transduction (Ca2, gene expression)
Plant Cell
Cell Wall
32
The arms race explained
An avirulence genes mutates so that its product
is no longer recognised by the host resistance
gene.
It therefore becomes a virulence gene relative to
the host, and the pathogen can infect.
The host resistance gene mutates to a version
which can detect the elicitor produced by the new
virulence gene.
33
Hypersensitive Reaction/ Programmed Cell
Death In response to signals, evidence suggests
that infected cells produce large quantities of
extra-cellular superoxide and hydrogen peroxide
which may 1. damage the pathogen 2. strengthen
the cell walls Oxidative 3. trigger/cause
host cell death Burst Evidence is accumulating
that host cell also undergo changes in gene
expression which lead to cell death Programmed
Cell Death
34
Systemic Acquired Resistance
Inducer inoculation
Local acquired resistance
3 days to months, then inoculate
Systemic acquired resistance
SAR- long-term resistance to a range of pathogens
throughout plant caused by inoculation with
inducer inoculum
35
Similarity with animals 1. Resistance/avirulence
gene interaction is analogous to animal
antibodies- involves protein-protein binding is
highly specific 2. Oxidative burst is analogous
to neutrophil action 3. Programmed cell death is
common to both plants and animals 4. Systemic
acquired resistance is like immunity
36
Marker Assisted Selection
  • Targets for crop improvements
  • Genetics of improvement
  • Molecular mapping
  • Mapping a qualitative trait
  • Marker assisted selection for aroma in rice
  • Marker assisted selection for multiple resistant
    genes
  • Mapping quantitative traits
  • QTLs and marker assisted selection

37
Targets for Improvement Targets for improvement
in rice production fall into three categories
Biotic constraints- (pests and diseases) Weeds,
Fungi (e.g. Blast), Bacteria (e.g. Blight),
Viruses (e.g. Rice yellow mottle virus), Insects
(e.g. Brown plant hopper), Nematodes (e.g.
Cyst-knot nematode) Abiotic constraints (adverse
physical environment) Drought, Nutrient
availability, Salinity Cold, Flooding Yield and
quality Plant morphology, Photosynthetic
efficiency, Nitrogen fixation, Carbon
partitioning, Aroma
38
Genetics of improvement Biotic constraints-
Qualitative (complete resistance) Quantitative
(partial resistance) Abiotic constraints- Quantit
ative (mostly) Yield and quality- Qualitative
(aroma, partitioning) Quantitative (morphology,
partitioning) Requires genetic engineering
(photosynthesis, n. fixation)
39
Marker Assisted Selection Useful when the
gene(s) of interest is difficult to select for.
1. Recessive Genes 2. Multiple Genes for
Disease Resistance 3. Quantitative traits 4.
Large genotype x environment interaction
40
Molecular Maps Molecular markers (especially
RFLPs and SSRs) can be used to produce genetic
maps because they represent an almost unlimited
number of alleles that can be followed in progeny
of crosses.
41
Molecular map of cross between rice varieties
Azucena and Bala. Mapping population is an F6
1
2
3
4
6
5
51 cM
54 cM
54 cM
51 cM
7
8
9
10
11
12
48 cM
MOLECULAR MAPS CAN BE USED TO LOCATE GENES FOR
USEFUL TRAITS (CHARACTERISTICS)
42
To locate useful genes on chromosomes by linkage
mapping, you need 1. A large mapping population
(100 individuals) derived from parental lines
which differ in the characteristic or trait you
are interested in. 2. Genotype the members of
the population using molecular markers which are
polymorphic between the parents (e.g. RFLPs,
AFLPs, RAPDs) 3. Phenotype the members of the
population for the trait making sure you asses
each individual as accurately as possible
43
Azucena x Bala F1 (self) 1
Individual F2 F2 F2 F2 F2 (self)
205 individuals F3 F3 F3 F3 F3
(self) 205 individuals F4 F4 F4 F4
F4 (self) 205 individuals F5 F5 F5 F5
F5 (self) 205 individuals F6 F6 F6
F6 F6 205 families
What is an F6 mapping population?
Single Seed Decent
Seed multiplication
44
Making A Linkage Map
Genotype No. of G320
RG2 C189 Individuals A A A 47 A A B
8 A B A 5 A B B 15 B A A
19 B B A 24 B A B 3 B B
B 42 . Total 163
Recombinants between G320 and RG2 5 15 19
3 42 26 Recombinants between RG2 and C189
8 5 24 3 40 25 Recombinants between
G320 and C189 8 15 19 24 66 40
45
Making a Linkage Map
46
Mapping a Qualitative Trait e.g. disease
resistance
For a complete resistance gene, one parent is
resistant, the other is susceptible The
individuals in the segregating population are
either resistant or susceptible.
47
Mapping a Qualitative Trait
48
Marker Assisted Selection for Aroma in Rice
The variety Azucena is aromatic (i.e. it smells
pleasant and its seeds smell and taste
pleasant) Therefore Azucena rice fetches a
higher price The aroma gene is recessive.
Therefore, it cant be followed in backcross
breeding. The gene for aroma has been mapped to
chromosome 8 Kalinga III is a popular variety in
Eastern India but it is not aromatic. The aroma
gene of Azucena has been crossed into Kalinga III
by selection for RFLPs linked to the aroma gene
49
Marker Assisted Selection Using molecular
markers as selection criteria rather than the
gene you want to transfer
Aroma gene flanked by G1073 and R2676
50
Marker Assisted Selection in Disease
Resistance Resistance genes can be selected for
by screening with the disease. So, conventional
breeding can produce resistant varieties. But,
resistance genes break-down. The disease organism
mutates to overcome them (in 2-3 years). If
there were several resistance genes, the disease
organism would take very much longer to overcome
all resistance genes (in fact it is virtually
impossible). But, you cant select for say 3
resistance genes conventionally- you cant tell
the difference between 1 gene and 2 or 3 by
phenotype. But if you select for markers linked
to the resistance genes, you can introduce
multiple resistance genes.
51
Marker Assisted Selection in Disease Resistance
Elite variety Donor1
Donor 2 Donor 3
Multiple crosses followed by backcrossing with
selection for markers at every stage
Elite variety with multiple resistance genes
52
Mapping a Quantitative Trait e.g. rooting depth
Root length gene
53
Mapping a Quantitative Trait e.g. rooting depth
Difference between parents is 360 mm Difference
between genotype classes at RG2 is 50 mm This
locus accounts for 16 of the difference
54
Quantitative trait loci (QTLs) and Marker
Assisted Selection
QTLs (the location of a gene contributing to a
quantitatively variable trait) are difficult to
select for conventionally it is very difficult
to identify individuals with the QTL from those
without because its effect is small. Marker
assisted selection can be used once markers at
the QTL have been found. Multiple QTLs can be
combined for greater effect.
55
Azucena QTLs targeted in the Marker Assisted
Selection to improve the root system of Kallinga
III
56
Genetic Engineering
Genetic transformations Agrobacterium
transformations Direct transfer methods for
transformation Transformation cassettes From
transformed cells to plants The use of
transformed plants in research Mutants Transposon
Transposon and T-DNA tagging
57
Genetic Engineering of Plants- Agrobacterium
transformation- The bacteria Agrobacterium
tumefaciens causes galls or tumors on plants
Ti Plasmid (tumor inducing)
Genomic DNA
58
Agrobacterium transformation 2
Infect plant with recombinant agrobacterium
59
GENETIC ENGINEERING without AGROBACTERIUM
All involve getting DNA directly across the
plasma membrane
60
Transformation constructs or cassettes
  • Genes of interest
  • Promoter
  • Selectable (marker) gene

Gene of interest
T-DNA
T-DNA
Promoter e.g. Cauliflower Mosaic Virus 35S RNA
gene promoter (CAM 35S)
Selectable marker-gene e.g. antibiotic resistance
or herbicide resistance
Allows transgenic cells to be selected from
non-transgenic
61
From transformed cells to plants
Plant cells are grown as a callus of
undifferentiated cells on agar plates
62
Transgenic plants as a research tool for
non-genetic studies e.g. aequorin transformed
plants to study calciums role as secondary
messenger
The aequorin gene from a luminescent jellyfish
produces a protein aequorin. When combined with a
small chromophore, coelentrazine, the complex
gives off blue light at a rate dependent on
Ca2.
When transformed in to tobacco, this gene can be
used to study the role of Ca2 in signal
transduction
Knight et al. 1991
63
Transgenic plants to identifying gene function
through novel expression eg ?-3fatty acid
desaturase from Arabidopsis in tobacco
  • ?-3fatty acid desaturase converts 162 and 182
    dienoic fatty acids to 163 and 183 trienoic
    acids.
  • A greater degree of fatty acid unsaturation
    (especially in the chloroplast) was thought to
    confer greater resistance to cold in plants.
  • Transformation of tobacco (which lacks the
    enzyme) with the enzyme from Arabidopsis,
    increases fatty acid unsaturation.

?-3fatty acid desaturase transformation confers
cold tolerance, confirming that unsaturation is
important.
64
Transgenic plants to identify gene function
through over expression e.g. over-expression of
antioxidant proteins
The Halliwell-Asada pathway
The Halliwell-Asada pathway is important in
detoxifying reactive oxygen intermediates. These
are produced naturally by the electron-transport
chains of mitochondria and especially
chloroplasts. Most stresses cause increases in
superoxide or hydrogen peroxide production.
Transgenic experiments have investigated the
importance of these enzymes in stress resistance.
O2.- H2O2 H2O
MDHA Ascorbate
DHA GSSG
GSH
NADP
NADPH
Superoxide Dismutase
Ascorbate peroxidase
Dehydroascorbate reductase
Glutathione reductase
65
Transgenic plants to identify gene function
through over expression e.g. over-expression of
antioxidant proteins
Gene Construct Host Plant Phenotype Superoxide
Dismutase Chloroplastic Tobacco No
protection from MV or O3 Reduced MV damage and
photoinhibition Reduced MV damage by no
protection of photoinhibition Tomato No
protection from photoinhibition Potato Reduced
MV damage Alfalfa Reduced aciflurofen, freezing
and drought damage Mitochondrial Tobacco Redu
ced MV damage in the dark Alfalfa Reduced
freezing and drought damage Cytosolic
Potato Reduced MV damage Ascorbate Peroxidase
Cytosoloc Tobacco Reduced MV damage and
photoinhibition Chloroplastic
Tobacco Reduced MV damage and photoinhibition Gl
utathione Reductase E. coli in
c.plast Tobacco Reduced MV and SO2 damage, not
O3 Poplar Reduced photoinhibition E. coli
in cytosol Tobacco Reduced MV damage
Pea Tobacco Reduced O3 damage, variable with MV
MV methyl viologen paraquat
Allen et al. 1997
66
Transgenic Plants to identifying gene function
through gene repression e.g. polygalacturinase
and fruit ripening in tomato
  • Polygalacturinase breaks down cell walls.
  • Its expression is considerably enhanced in
    ripening fruit (it makes the fruit soft).
  • Transformation of tomatoes with the anti-sense
    version (the gene in the opposite direction),
    reduces the expression of polygalacturinase.

Result- tomatoes dont soften so quickly- FLAVR
SAVR TOMATO
67
Transgenic plants to study of promoter function
through reporter gene studies e.g. ABA responsive
promoter from barley
Section of the upstream region of a barley ABA
responsive gene CCGGCTGCCCGCCACGTACACGCCAAGCACCCGG
TGCCATTGCCACCGG -104 -56
(Shen and Ho 1997)
Reporter gene (GUS)
Minimal promoter
ABA responsiveness GUS activity in the
presence of ABA related to no ABA 1x 38x
24x 55x 87x
68
Mutants and Plant Genetics DNA damage- X and
Gamma rays, sodium azide (NaN3) Transposons and
T-DNA tagging
A transposon can move at random throughout a
plant genome. It is cut out of its site and
reinserted into another site by the action of an
endonuclease and the transposase. Insertion
into a functional gene causes mutation.
69
Transposons and T-DNA tagging
Transposons have only been found in a few plants
(e.g. Maize, Antirrhium). But, they can be
introduced by transformation. The Ac transposon
has been introduced to tobacco, Arabidopsis,
potato, tomato, bean and rice.
Mutations using transposons or T-DNA (both of
which insert randomly into nuclear DNA) are
produced by transformation methods described
earlier. Large numbers of plants are screened
for an observable phenotype (e.g. lack of
response to light).
70
Transposons and T-DNA tagging
The gene into which the insert has occurred can
be recovered by PCR
Insertion (Transpososn or T-DNA)
Mutated ORF
About PowerShow.com