Using mouse genetics to understand human disease - PowerPoint PPT Presentation

Loading...

PPT – Using mouse genetics to understand human disease PowerPoint presentation | free to download - id: 56eab9-NzViZ



Loading


The Adobe Flash plugin is needed to view this content

Get the plugin now

View by Category
About This Presentation
Title:

Using mouse genetics to understand human disease

Description:

Using mouse genetics to understand human disease Mark Daly Whitehead/Pfizer Computational Biology Fellow What we do Genetics: the study of the inheritance of ... – PowerPoint PPT presentation

Number of Views:337
Avg rating:3.0/5.0
Slides: 42
Provided by: MARKD178
Learn more at: http://wi.mit.edu
Category:

less

Write a Comment
User Comments (0)
Transcript and Presenter's Notes

Title: Using mouse genetics to understand human disease


1
Using mouse genetics to understand human disease
Mark Daly Whitehead/Pfizer Computational
Biology Fellow
2
What we do
  • Genetics the study of the inheritance of
    biological phenotype
  • Mendel recognized discrete units of inheritance
  • Theories rediscovered and disputed ca. 1900
  • Experiments on mouse coat color proved Mendel
    correct and generalizable to mammals
  • We now recognize this inheritance as being
    carried by variation in DNA

3
Why mice?
What do they want with me?
  • Mammals, much better biological model
  • Easy to breed, feed, and house
  • Can acclimatize to human touch
  • Most important we can experiment in many ways
    not possible in humans

4
Mice are close to humans
5
Kerstin Lindblad-Toh Whitehead/MIT Center for
Genome Research
6
Mouse sequence reveals great similarity with the
human genome
Extremely high conservation 560,000 anchors
Mouse-Human Comparison both genomes 2.5-3
billion bp long gt 99 of genes have homologs gt
95 of genome syntenic
7
Genomes are rearranged copies of each other
Roughly 50 of bases change in the evolutionary
time from mouse to human
8
Mouse sequence reveals great similarity with the
human genome
Extremely high conservation 560,000 anchors
Anchors (hundreds of bases with gt90
identity) represent areas of evolutionary
selection but only 30-40 of the highly
conserved segments correspond to exons of genes!!!
9
What we can do
YIKES!!!
  • Directed matings
  • Inbred lines and crosses
  • Knockouts
  • Transgenics
  • Mutagenesis
  • Nuclear transfer
  • Control exposure to pathogens, drugs, diet, etc.

10
Example diabetes related mice available from The
Jackson Labs
  • Type I diabetes (3)
  • Type II diabetes (3)
  • Hyperglycemic (27)
  • Hyperinsulinemic (25)
  • Hypoglycemic (1)
  • Hypoinsulinemic (5)
  • Insulin resistant (30)
  • Impaired insulin processing (7)
  • Impaired wound healing (13)

11
Inbreeding
  • Repeated brother-sister mating leads to
    completely homozygous genome no variation!

12
Experimental Crosses
  • Breed two distinct inbred lines
  • Offspring (F1) are all genetically identical
    they each have one copy of each chromosome from
    each parent
  • Further crosses involving F1 lead to mice with
    unique combinations of the two original strains

13
Experimental Cross
14
Experimental Cross backcross
  • F1 bred back to one of the parents
  • Backcross (F1 x RED) offspring
  • 50 red-red
  • 50 red-blue

15
Experimental Cross F2 intercross
  • One F1 bred to another F1
  • F2 intercross (F1xF1) offspring
  • 25 red-red
  • 50 red-blue
  • 25 blue-blue

F2
16
Trait mapping
100 200 300
17
Trait mapping
Blue trees tall, Red trees short In the F2
generation, short trees tend to carry red
chromosomes where the height genes are located,
taller trees tend to carry blue chromosomes
QTL mapping use statistical methods to find
these regions
18
How do we distinguish chromosomes from different
strains?
  • Polymorphic DNA markers such as Single Nucleotide
    Polymorphisms (SNPs) can be used to distinguish
    the parental origin of offspring chromosomes

ATTCGACGTATTGGCACTTACAGG ATTCGATGTATTGGCACTTACAGG
SNP
19
Example susceptibility to Tb
  • C3H mice extremely susceptible to Tb
  • B6 mice resistant
  • F1, F2 show intermediate levels of susceptibility

20
One gene location already known
  • Previous work identified chromosome 1 as carrying
    a major susceptibility factor
  • Congenic C3H animals carrying a B6 chromosome 1
    segment were bred

21
Congenic and consomic mice
  • Derived strains of mice in which the homozygous
    genome of one mouse strain has a chromosome or
    part of a chromosome substituted from another
    strain

C3H B6
C3H.B6_chr1
Chr 1 Chr 2 Chr 3 Chr 4 Etc.
22
Tb mapping cross
F2 intercross C3H.B6-sst1 - MTB-susceptible,
carrying B6 chr 1 resistance B6 -
MTB-resistant Trait survival following MTB
infection
x
B6
C3H.B6-sst1
x
F1

F2
n 368
23
Results 3 new gene locations identified!
24
Gene identified on chromosome 12
At the end of chr 12 mice inheriting two C3H
copies survive significantly longer than those
with one or two B6 copies Mice engineered to
be missing a critical component of the immune
system located in this region are likewise more
susceptible, validating that particular gene as
involved in Tb susceptibility
25
(No Transcript)
26
(No Transcript)
27
Mouse History
  • Modern house mice emerged from Asia into the
    fertile crescent as agriculture was born

28
Mouse history
29
Recent mouse history
Fancy mouse breeding - Asia, Europe (last few
centuries) Retired schoolteacher Abbie
Lathrop collects and breeds these mice Granby, MA
1900 Castle, Little and others form most
commonly used inbred strains from Lathrop
stock (1908 on)
W.E. Castle C.C. Little
30
Mouse history
31
Mouse history
  • Asian musculus and European domesticus mice
    dominate the world but have evolved separately
    over 1 Million years
  • Mixing in Abbie Lathrops schoolhouse created all
    our commonly used mice from these two distinct
    founder groups

32
(No Transcript)
33
Genetic Background of the inbred lab mice
C57BL/6
musc
musc
domest
musc
domest
domest
C3H

musc
domest
domest
DBA
cast
Avg segment size 2 Mb
34
Comparing two inbred strains frequency of
differences in 50 kb segments


lt1 SNP/10 kb
40 SNP/10 kb
35
Finding the genes responsible for biomedical
phenotypes
C3H (susceptible) B6 (resistant)
Traditionally positional cloning is
painful (e.g., generating thousands of mice for
fine mapping, breeding congenics) As a result,
countless significant QTLs have been identified
in mapping crosses but only a small handful have
thusfar resulted in identification of which gene
is responsible the critical information that
will advance research into prevention and
treatment!
36
Using DNA patterns to find genes
C3H (susc.) B6 (res.) Critical Region
37
Using DNA patterns to find genes
C3H (susc.) B6 (res.) DBA (susc.) Critical Region
38
Example mapping of albinism
Critical region
39
First genomic region mapped
129S1 T A C C C C G G T A C G A G G G
AKR A G T T T A A T G G T A C G A G G G
A_J A G T T T A A T G G T A C G A G G G
BALB_c T A C C C G C G G T A C G A G G G
C3H A G T T T A A T G G T A C G A G G G
C57B6 A G T T T A A T C T A G T A C C C A
CBA A G T T T A A T C T A G T A C C C A
DBA2 A G T T T A A T C T A G T A C C C A
FVB A G T T T A A T C T A G T A C C C A
I A G T T T A A T G G T A C G A G G G
NOD A G T T T A A T G G T A C G A G G G
NZB A C C C C C C T G T A C C C A
SJL A G T T T A A T C T A G T A C C C A
SWR A G T T T A A T C T A G T A C C C A
Chr 4 35.7
37.6 37.9
39.4 (Mb)
40
Future Genetic Studies
Mapping
Expression
Pathways
Model Systems
41
Thanks to
(Whitehead Institute) Claire Wade Andrew
Kirby (MIT Genome Center) EJ Kulbokas Mike
Zody Eric Lander Kerstin Lindblad-Toh Funding W
hitehead Institute Pfizer, Inc. National Human
Genome Research Institute
About PowerShow.com