Using Zinc Finger Nucleases to Manipulate the Mammalian Genome - PowerPoint PPT Presentation

Loading...

PPT – Using Zinc Finger Nucleases to Manipulate the Mammalian Genome PowerPoint presentation | free to download - id: 417b5a-NzQ1Y



Loading


The Adobe Flash plugin is needed to view this content

Get the plugin now

View by Category
About This Presentation
Title:

Using Zinc Finger Nucleases to Manipulate the Mammalian Genome

Description:

Using Zinc Finger Nucleases to Manipulate the Mammalian Genome Matthew Porteus UT Southwestern Medical Center Depts. of Pediatrics and Biochemistry – PowerPoint PPT presentation

Number of Views:205
Avg rating:3.0/5.0
Slides: 41
Provided by: MatthewP157
Learn more at: http://www.sens.org
Category:

less

Write a Comment
User Comments (0)
Transcript and Presenter's Notes

Title: Using Zinc Finger Nucleases to Manipulate the Mammalian Genome


1
Using Zinc Finger Nucleases to Manipulate the
Mammalian Genome
Matthew Porteus UT Southwestern Medical
Center Depts. of Pediatrics and
Biochemistry Dallas, TX
2
Gene Targeting is a Precise Recombination Event
Definition Gene targeting is the replacement of
genomic DNA with exogenous DNA by homologous
recombination.
Commonly Used For Experimental Purposes in
certain cell types (yeast, chicken DT40 cells,
murine embryonic stem cells)
In addition to its usefulness for mammalian
somatic cell genetics, it could also be an ideal
way to treat genetic diseases.
3
GFP Gene Targeting System
CMV/CBA-GFP-IRES-CD8a-PGK-Neo
Stop-Sce Site
4
DSB-Induced Gene Targeting
CMV/CBA-GFP-IRES-CD8a-PGK-Neo
Optimized Rate3-5 (30-50,000 events per
million transfected cells)
Porteus and Baltimore (2003)
5
Two Components for DSB-Induced Homologous
Recombination
  1. Repair Substrate Fragment of DNA that serves as
    template for repair of DSB by homologous
    recombination.
  2. Nuclease Enzyme to create DSB in target gene.

6
Schema of DSB-Induced Gene Conversion
S
Undamaged DNA (Allele S) DSB Created
(spontaneous or induced, e.g. by ZFN ) Strand
Invasion into Undamaged Homologous DNA (Allele
A) In gene targeting exogenous DNA serves as
homologous DNA donor. Repairing of original
strands of DNA. Gaps filled by DNA polymerase and
nicks sealed by DNA ligase. Conversion of Blue
Allele(S) into Red Allele (A) in region of DSB
A
A
7
Endogenous Genes Do Not have Recognition Sites
for Homing Endonucleases
  1. Modify Homing Endonucleases to Recognize new
    target sites.
  2. Use Zinc Finger Nucleases

8
Zinc Finger Nucleases as Potential Reagents to
Create Double-Strand Breaks in Normal Genes
FokI nuclease domain (Fn)
FokI nuclease domain (Fn)
Initially developed by labs of Srinivasan
Chandrasegaran (Johns Hopkins) and Dana Carroll
(Univ. Utah)
9
ZFN Full Site/Sce Site
GFP
CD8
CMV/CBA
IRES
WRE
Sce or ZFN Expression Plasmid
tGFP
GFP Donor
CD8
FP
G
IRES
WRE
CMV/CBA
tGFP
GFP
CD8
CMV/CBA
IRES
WRE
10
Model Zinc Finger Nucleases Stimulate Gene
Targeting
QQR Site
6
Zif Site
Sce Site
7000
4150
4785
6000
5000
4000
3000
2000
1000
53
14
0
Sce QQRL0 Zif QQRL0/Zif
Porteus and Baltimore (2003)
11
Continuous Expression of ZFNs causes Cytotoxicity
Time Course of Gene Targeting Using Sce
Relative Rate of Gene Targeting
Time Course of Gene Targeting Using Zinc Finger
Nucleases
12
(No Transcript)
13
Can we design a pair of zinc finger nucleases to
stimulate gene targeting in a real gene in human
somatic cells?
14
Zinc Fingers Bind Triplets
15
How to assemble a new zinc finger protein?
  • By altering the contact residues one can alter
    the target triplet.
  • By mixing different fingers one can assemble a
    zinc finger protein with new target site
    specificity.
  • Theoretically if one had zinc fingers for all 64
    possible triplets one could assemble a zinc
    finger protein to recognize any sequence.
  • Zinc fingers have been published that recognize
    all 16 GNN,ANN, CNN triplets.
  • But, the GNN fingers are best.

16
Can we assemble a pair of zinc finger nucleases
to stimulate gene targeting?
Full Site Consensus Sequence 5
nnCnnCnnCnnnnnnGnnGnnGnn 3 (GNNGNNGNN inverted
repeat separated by 6 bp)
Such a sequence occurs in both GFP (twice) and CD8
Lucky, eh?
17
Empiric Design of Zinc Finger Nucleases (assembly
approach)
From Liu et al. (2002)
18
Gene Targeting with Zinc Finger Nucleases to GFP
Fn
GFPZF2
5 acC atC ttC ttc aag Gac Gac Ggc aac stop-Sce
site tac
3 tgG taG aaG aag ttc Cgc Ctg Ccg ttc
GFPZF1
Fn
Finger1 Finger2 Finger3 GFPZFN-1
QSSHLTR TRGNLVR QSGNLAR (ggt) (gat)
(gaa) GFPZFN-2 DRSHLTR DRSNLTR DRSNLTR
(ggc) (gac) (gac)
19
Sce Site
GFP ZFN Site
GFP
CD8
CMV/CBA
IRES
WRE
Sce or ZFN Expression Plasmid
tGFP
GFP Donor
CD8
FP
G
IRES
WRE
CMV/CBA
tGFP
GFP
CD8
CMV/CBA
IRES
WRE
20
Gene Targeting with Zinc Finger Nucleases to GFP
GFP Positive Cells per Million Transfected Cells
Sce GFPZF1-Fn
GFPZF2-Fn
21
CD8 Knockout Using Zinc Finger Nucleases
Fn
CD8ZF2
bp 441 5acc ggCgcCcaC catcgc GtcGcaGcc ctg 3 bp
471 tgg ccGcgGgtG gtagcg CagCgtCgg gac
CD8ZF1
Fn
22
Knockout of CD8 transgene Using CD8 Zinc Finger
Nucleases
85 CD8 Positive
Cell Line
CMV/CBA
GFP
IRES
CD8
CD8 Knockout Plasmid
10/10 clones CD8
16 CD8 Negative
CD8 Knockout Plasmid CD8 ZFNs
0/12 clones CD8
80 CD8 Negative
23
Demonstrates in Principle
  • Can make somatic cell knock-outs with ZFNs
  • Can do targeted transgenesis with ZFNs.
  • i.e. Substitute gene of interest for selectable
    marker (or both. . .) and insert into
    pre-selected, safe and permissive genomic
    location.

24
How far from the site of the break can you get
targeting?
25
Co-conversion of Markers by Gene Targeting
37GFP-IRES-Puro-IRES-CD8
CMV-Sce
37GFP-IRES-Puro-IRES-CD8
CMV/CBA-GFP-IRES-CD8a-PGK-Neo
Stop-Sce Site
Stop-Sc e Site
26
Frequency of Co-Conversion using DSB Mediated
Gene Targeting
CMV/CBA-GFP-IRES-Puro-IRES-CD8a-PGK-Neo
Day 3 Day17 Fold Change
(no puro) (puro selection) GFP
Cells 0.041 58
1400 Total GFP Cells 1200 66
(-18) GFP Cells 0.013
17
1200 Total GFP Cells 405
2 (-200)
27
Demonstrates
  • Can get targeting at a distance (up to 400 bp)
    from site of DSB (at a price).
  • Can do co-conversion
  • i.e. Correct mutation at one location and insert
    gene that confers selective advantage nearby.

28
Can we design zinc finger nucleases to stimulate
gene targeting in a gene that causes human
disease?
Collaboration with Sangamo Biosciences (Richmond,
CA)
29
Human Interleukin-2 Receptor Common Gamma Chain
Deficiency (IL2RG)
  • Part of Receptor Complex for IL-2, IL-4, IL-7,
    IL-9, IL-15, IL-21. . .
  • On X-chromosome
  • Mutations in which are the most common cause of
    SCID (severe combined immunodeficiency)
  • -25 of mutations lie in Exon 5.
  • 4. Selective Advantage for corrected cells.

5. Treatment -Bone Marrow Transplantation
Allogeneic (sibling) Haploidentical
(parent) -Gene Therapy Alain Fischer trial
in France Ooops, leukemia.
30
ZFN Gene Correction at the IL2RG gene
IL2RG ZFN-R 5CTACACGTTTCGTGTTCGGAG
CCGCTTTAACCCACTCTGTGGAAGTGCTC 3 3GATGTGCAAAGCACA
AGCCTCGGCGAAATTGGGTGAGACACCTTCACGAG 5
IL2RG ZFN-L
GFP Gene Targeting Reporter for IL2RG ZFNs
5 GFP
3 GFP
Sce site
IL2RG site
Target site of GFP ZFNs
31
Stimulation of Gene Targeting Using ZFNs for the
IL2RG Gene
2500
1968
2000
GFP Positive Cells per Million Transfected Cells
1500
715
1000
500
0
IL2RG ZFN-L IL2RG ZFN-R
GFP ZFNs
5-8L0/5-9L0
M16/M17
32
Optimization of IL2RG ZFN-L
5000
3892
4500
4000
2897
3500
GFP Positive Cells per Million Transfected Cells
3000
2500
1276
2000
1500
1000
500
0
IL2RG ZFN-R IL2RG ZFN-R IL2RG
ZFN-R IL2RG ZFN-L IL2RG ZFN-L(D) IL2RG
ZFN-L(G)
33
Optimization of cgc ZFN-R
5000
4420
4500
4000
3500
GFP Positive Cells per Million Transfected Cells
2943
2940
3000
2689
2656
2500
1937
2000
1500
1000
500
0
cgc ZFN-LG cgc ZFN-LG cgc ZFN-LG cgc ZFN-LG
cgc ZFN-LG cgc ZFN-LG cgc ZFN-R cgc ZFN-R
cgc ZFN-R cgc ZFN-R cgc ZFN-R cgc
ZFN-R (A) (B)
(C) (D) (E)
1
2
3
4
5
6
34
4-Finger Zinc Finger Nucleases Seem to Have Less
Cytotoxicity
GFP Positive Cells per Million Transfected Cells
Day3 Day5 Day7
35
Experimental Design to Detect Targeting at
Endogenous IL2RG Locus
  1. Transfect K562 cells with IL2RG ZFNs with repair
    substrate that contains BsrBI polymorphism.
  2. Isolate individual clones (no selection).
  3. Expand individual clones (no selection).
  4. Harvest genomic DNA from individual clones.
  5. Analyze genomic DNA for BsrBI polymorphism.

36
Bi-Allelic Targeting in Human Somatic Cells (K562)
Total clones 76 Corrected 14 (18)
bB 9 (11.5)
BB 5 (6.5)
37
Future Directions
  • Design ZFNs to other target genes.
  • Develop efficient method to make specific ZFNs
    that recognize a broad range of sequences.
  • Refine ZFNs for use in primary cells, including
    stem cells.
  • Assess possible induction of genomic
    rearrangements by ZFNs.
  • Eliminate
  • Use as a tool to study sequence specific DSBs in
    genetic instability.
  • Develop as a therapeutic tool.

38
Potential Applications to Aging Research
  1. Audience will be more clever than I.
  2. Use as an experimental tool to study genetics of
    aging in mammalian cells.
  3. Create allele specific gene variants in stem
    cells that are associated with slower aging.

39
Thank You
UT Southwestern Patrick Connelly Ruth
Ebangit Brian Ellis Shondra Pruett Kimberly
Wilson Funding Burroughs-Wellcome Fund Career
Development Award NIH Career Development Award UT
Southwestern Medical Center
Sangamo Biosciences Fyodor Urnov Michael
Holmes Jeff Miller Philip Gregory Casey Case
40
(No Transcript)
About PowerShow.com