The From Data to Knowledge FDK Research Unit a National Center of Excellence - PowerPoint PPT Presentation

Loading...

PPT – The From Data to Knowledge FDK Research Unit a National Center of Excellence PowerPoint presentation | free to view - id: ff4e1-ZDc1Z



Loading


The Adobe Flash plugin is needed to view this content

Get the plugin now

View by Category
About This Presentation
Title:

The From Data to Knowledge FDK Research Unit a National Center of Excellence

Description:

The From Data to Knowledge (FDK) Research Unit a National ... Antonin Doucet: Advanced document description, a sequential approach. postdoc at INRIA, France ... – PowerPoint PPT presentation

Number of Views:21
Avg rating:3.0/5.0
Slides: 13
Provided by: csHel
Category:

less

Write a Comment
User Comments (0)
Transcript and Presenter's Notes

Title: The From Data to Knowledge FDK Research Unit a National Center of Excellence


1
The From Data to Knowledge (FDK) Research Unit
a National Center of Excellence
  • Esko Ukkonen

Department of Computer Science
2
Structure of the FDK
  • national Center-of-Excellence status (Academy of
    Finland) for 2002-2007 basic funding 267 k /
    year
  • host institutions
  • University of Helsinki, Dept of Computer Science
  • Helsinki University of Technology, Laboratory of
    Computer and Information Science
  • about 60 members
  • professors
  • Esko Ukkonen (director, academy professor -2004)
  • Heikki Mannila (academy professor 2004 -)
  • Hannu Toivonen
  • Helena Ahonen-Myka
  • Juho Rousu (2005 -)
  • Tapio Elomaa -gt Tampere Univ of Technology
  • Jaakko Hollmén (HUT)

3
Mission and goals
  • The FDK unit develops methods for forming useful
    knowledge from large masses of data. The unit
    operates in multi-disciplinary fashion,
    integrating in its research groups excellence in
    computational methods, statistical techniques,
    and application sciences.
  • data gt computational methods gt knowledge
  • problem gt concepts and formalization gt
    algorithm gt algorithm analysis gt
    implementation gt evaluation in practice
  • Bioinformatics PhD Programme (1997),
    international Masters Programme (2006)

4
Core competence
  • Combinatorial Pattern Matching matching and
    finding patterns in strings and in more complex
    discrete structures, deriving their combinatorial
    properties, and exploiting these to achieve
    superior performance for the corresponding
    computational problems (Esko Ukkonen 1980 - )
  • Data Mining finding interesting and useful
    patterns from masses of data (Heikki Mannila 1992
    - )
  • gt Combinatorial algorithms probabilistic
    models
  • Strong international status Mannila Toivonen
    Ukkonen among top-ten of most cited Finnish
    computer scientists

5
Highlights 25 PhD dissertations from FDK
  • Mannila group
  • Pirjo Moen Similarity notions for data mining.
  • lecturer at CS/UH
  • Barbara Heikkinen Document structures and
    document assembly.
  • Nokia Research
  • Vesa Ollikainen Simulation techniques for
    disease gene localization.
  • Center for Scientific Computing
  • Marko Salmenkivi Computational methods for
    intensity models.
  • postdoc at CS/UH
  • Mikko Koivisto Algorithms for the analysis of
    genetic risks.
  • Academy postdoc at HIIT/BRU
  • HMM techniques for genome analysis

6
Highlights 25 PhD dissertations (cont.)
  • Mannila group (cont)
  • Jouni Seppänen (HUT) Using and extending
    itemsets in data mining query approximation,
    dense itemsets, and tiles
  • postdoc HUT
  • Taneli Mielikäinen Summarization techniques for
    pattern collections in data mining
  • Nokia Research, Palo Alto, Ca
  • Antti Leino On toponymic constructions as an
    alternative to naming patterns in describing
    Finnish lake names
  • Center for the Languages of Finland
  • Evimaria Terzi Problems and algorithms for
    sequence segmentations
  • IBM Almaden

7
Highlights 25 PhD dissertations (cont)
  • Toivonen group
  • Kari Vasko Computational methods for
    paleoecology.
  • Center for Scientific Computing
  • private company Ekahau
  • Petteri Sevon Association-based gene mapping.
  • Karolinska Institutet
  • project manager at HIIT/BRU
  • Mika Raento Exploring privacy for ubiquitous
    computing tools, methods and experiments
  • private company Jaiku

8
Highlights 25 PhD dissertations (cont)
  • Elomaa group
  • Juho Rousu Range partitioning in classification
    learning.
  • VTT Biotech, postdoc London/Southampton (Marie
    Curie)
  • now professor of bioinformatics at CS/UH
  • dataflow techniques for metabolic modeling
  • machine learning for structured data
  • Matti Kääriäinen Learning small trees and graphs
    that generalize.
  • postdoc at International Computer Science
    Institute (ICSI) of UC Berkeley (Richard Karps
    group)
  • postdoc at HIIT

9
Highlights 25 PhD dissertations (cont)
  • Ahonen-Myka group
  • Antonin Doucet Advanced document description, a
    sequential approach
  • postdoc at INRIA, France
  • Miro Lehtonen Indexing heterogeneous XML for
    full-text search
  • postdoc at FDK
  • Lili Aunimo Methods for answer extraction in
    textual question answering
  • research coordinator at EVTEK Polytechnic

10
Highlights 25 PhD dissertations (cont)
  • Ukkonen group
  • Kimmo Fredriksson Rotation invariant matching.
  • Academy postdoc at Univ Joensuu, Finland
  • Jaak Vilo Pattern discovery from biosequences.
  • European Bioinformatics Institute (UK)
  • Egeen Ltd Univ Tartu, Estonia
  • Kjell Lemström String matching for music
    retrieval.
  • City Univ London
  • Academy Research Fellow at CS/UH
  • music retrieval
  • Veli Mäkinen Parametrized approximate string
    matching.
  • postdoc in Bielefeld
  • lecturer, postdoc and Academy Research Fellow at
    CS/UH

11
Highlights 25 PhD dissertations (cont)
  • Ukkonen group (cont)
  • Janne Ravantti Reconstruction of macromolecular
    complexes from electron microscopy images.
  • postdoc at Structural biology CoE at Dept Biology
    of UH
  • Teemu Kivioja Computational tools for a
    transcriptional profiling method.
  • researcher at VTT Biotech and Biomedicum UH
  • Hellis Tamm Minimality of multitape finite
    automata.
  • postdoc in Tallinn, Estonia
  • Ari Rantanen Algorithms for 13C metabolic flux
    analysis
  • postdoc ETH, Zurich

12
Future Algorithmic Data Analysis (ALGODAN) new
CoE for 2008-2013
  • Sequence analysis
  • Learning from and mining structured and
    heterogeneous data
  • Discovery of hidden structure in
    high-dimensional data
  • Foundations of algorithmic data analysis

cgccgagtgacagagacgctaatcaggctgtgttctcaggatgcgtac
About PowerShow.com