Aucun titre de diapositive - PowerPoint PPT Presentation

Loading...

PPT – Aucun titre de diapositive PowerPoint presentation | free to download - id: cc94f-ZDc1Z



Loading


The Adobe Flash plugin is needed to view this content

Get the plugin now

View by Category
About This Presentation
Title:

Aucun titre de diapositive

Description:

highly instable (no genome is actually duplicated, except for ... MAT cassettes and centromeres. Charting genome evolution. tandem repeat formation mechanism ... – PowerPoint PPT presentation

Number of Views:26
Avg rating:3.0/5.0
Slides: 67
Provided by: Duj9
Learn more at: http://www.pasteur.fr
Category:

less

Write a Comment
User Comments (0)
Transcript and Presenter's Notes

Title: Aucun titre de diapositive


1
How Eukaryotic Genomes Evolve the example of
Yeasts
Berbnard Dujon Institut Pasteur, Paris
Bioinformatics and Genome data Analysis
2
MECHANISMS OF DUPLICATIONS
Whole genome duplications polyploidization
(auto- or allo-) accidental (rare) highly
instable (no genome is actually duplicated,
except for some plants) Segmental
duplications various sizes of chromosome
segments (several adjacent genes) intra- or
inter- chromosomal frequent (human) chimeric
genes (domain accretion) sufficiently
stable Tandem gene repeat formation arrays of
paralogs instable (looping out) rapid
divergence Dispersed (single) gene duplications
(retrogenes) transposon-mediated chimeric genes
(domain accretion)
3
WHOLE GENOME DUPLICATIONS
4
The genome of Saccharomyces cerevisiae, 1997
5
Duplicated chromosomal blocs in S. cerevisiae
Chromosome 4
YDR201w
YDR210w
YDR211w
YDR200c
YDR204w
YDR205w
YDR206w
YDR208w
YDR212w
YDR213w
YDR214w
YDR216w
YDR221w
YDR222w
YDR202c
YDR207c
YDR209c
YDR215c
YDR217c
YDR218c
YDR219c
YDR220c
Chromosome 12
YLR237w
YLR236c
YLR226w
YLR234w
YLR238w
YLR225c
YLR233c
YLR227c
YLR228c
YLR229c
YLR231c
6
DUPLICATED BLOCKS IN THE GENOME OF S. cerevisiae
Wolfe and Schields, Nature (1997) 387 708-713
Seoighe and Wolfe, Gene (1999) 238 253-261
7
DUPLICATED BLOCKS IN THE GENOME OF S. cerevisiae
60 to 80 ancient duplicated blocks can be
identified in the entire yeast genome
Total number of genes into identified blocks
3391 (58 of genome)
WHOLE GENOME DUPLICATION FOLLOWED BY MASSIVE
(ca. 92) LOSS OF PARALOGOUS COPIES Nb of
 unique  gene prior to duplication 5800-449
5351 Nb of paralogous copies lost 5351-449
4902 Fraction of paralogous copies lost 4902 /
5351 91.6
8
Charting genome evolution
Overall genome redundancy 44 35 32
51 42
extensive loss of duplicated genes
S. cerevisiae
accidental genome duplication
4
reductive evolution
MAT cassettes and centromeres
C. glabrata
3
2
K. lactis
tandem repeat formation mechanism
1
D. hansenii
Y. lipolytica
9
SIGNATURES OF A WHOLE GENOME DUPLICATION
COMPARISON OF MAPS BETWEEN A DUPLICATED SPECIES
AND NON DUPLICATED SPECIES e.g. S. cerevisiae
and K. lactis Dujon et al. Nature (2004) 430
35-44 S. cerevisiae and K. waltii Kellis et al.
Nature (2004) 428 617-624 S. cerevisiae and
Ashbya gossypii Dietrich et al. (2004) Science
304 304-307 Tetraodon negroviridis and Homo
sapiens Jaillon et al. Nature (2004) 431
946-957 one to two relationship between
intermingled segments
COMPARISON BETWEEN TWO DUPLICATED SPECIES
ORIGINATING FROM THE SAME EVENT e.g. S.
cerevisiae and C. glabrata Dujon et al. Nature
(2004) 430 35-44 coincidence between
duplicated blocks
10
Ancient duplicated blocks in each genome
C. glabrata
S. cerevisiae
S. cerevisiae C. glabrata Total nb of
duplicated blocks internal to chromosomes
56 20 subtelomeric 21 0 Block
size (kb) mean 42 27 max.
243 89 Nb of gene pairs /block mean
5.8 3.8 max. 15 6
Application of ADHoRe (Vandepoele et al. 2002)
(r2 cutoff 0.8, max gap 35, min pair 3)
11
other chromosomes
chromosome of interest (X)
Hypothetical ancestor
genome duplication
other chromosomes
chromosome A
chromosome B
other chromosomes
Comparison between species 1 and species 2
12
MAP OF K. waltii GENOME RELATIVE TO S. cerevisiae
Kellis et al. Nature (2004) 428 617-624
13
RECONSTRUCTION OF S. cerevisiae DUPLICATED BLOCKS
RELATIVE TO K. waltii
Kellis et al. Nature (2004) 428 617-624
14
DISTRIBUTION OF IDENTITY BETWEEN PARALOGOUS GENE
PAIRS IN FISHES
Tetraodon negroviridis
Takifugu rubripes
ancient duplicated pairs
ancient duplicated pairs
Jaillon et al. Nature (2004) 431 946-957
15
MAP OF ANCIENT DUPLICATED PAIRS ON ENTIRE GENOME
OF Tetraodon negroviridis
Jaillon et al. Nature (2004) 431 946-957
16
Ancestral karyotype of bony vertebrates (12
chromosomes)
Amplification of transposoable elements
Duplication
Translocations and fusions
Fusions
Human
Tetraodon
Jaillon et al. Nature (2004) 431 946-957
17
SEGMENTAL DUPLICATIONS
18
Segmental duplications in mammalian genomes
segments of sequences of 90 identity
(recent) and 1 kb in length (weak criterion) or
5kb in length (more stringent)
Example rat genome
interchromosomal
intrachromosomal
Total 2.9 of genome (rat) 1-2 of genome
(mouse) 5-6 of genome (human)
Gibbs et al. Nature (2004) 428 493-521
19
DETAILED MAP OF SEGMENTAL DUPLICATIONS ON HUMAN
CHROMOSOME 16
interchromosomal
intrachromosomal
also deteceted by whole genome shogun
centromere
Martin et al. Nature (2004) 432 988-994
20
DISTRIBUTION OF LENGTHS AND IDENTITIES OF
SEGMENTAL DUPLICATIONS
Human chromosome 16
Rat genome
Martin et al. Nature (2004) 432 988-994
Tuzun et al. Genome Res. (2004) 14 493-506
21
Charting genome evolution
Overall genome redundancy 44 35 32
51 42
extensive loss of duplicated genes
S. cerevisiae
accidental genome duplication
4
reductive evolution
MAT cassettes and centromeres
C. glabrata
3
2
K. lactis
tandem repeat formation mechanism
1
D. hansenii
Y. lipolytica
22
Ancient duplicated blocks in each genome
K. lactis
D. hansenii
Y. lipolytica
K. lactis D. hansenii Y. lipolytica Total
nb of duplicated blocks internal to
chromosomes 8 5 2 sutelomeric
1 10 0 Block size (kb) mean 9 19
90 max. 25 59 148 Nb of gene pairs
/block mean 4.3 3.7 4.0 max. 11
6 4
?
Sporadic segmental duplications
23
Spontaneous segmental duplications in the yeast
genome experimental design
R. KOSZUL, S. CABURET, B. DUJON, G. FISCHER
Eucaryotic genome evolution through the
spontaneous duplication of large chromosomal
segments EMBO J. (2004) 23, 234-243
24
(No Transcript)
25
(No Transcript)
26
(No Transcript)
27
(No Transcript)
28
(No Transcript)
29
Formation of chimeric ORFs at junctions
intrachromosomal segmental duplications YKF1072 i
n frame fusion between YOR329c (SDC5) and
YOR267c chimeric protein YKF1057 in frame fusion
between YOR372c (NDD1) and YOR267c chimeric
protein YKF1223 in frame fusion between YOR336w
(KRE5) and YOR227w chimeric protein YKF1022 out
of frame fusion between YOR328w and
YOR272w truncated protein YKF1159 antiparallel
fusion between YOR357c and YOR269w truncated
protein YKF1050 fusion between YOR328w and
intergene truncated protein YKF1080 fusion
between YOR370c and intergene truncated
protein YKF1124 fusion between intergene and
YOR220w truncated protein YKF1175 fusion
between LTRs YKF1095 fusion between intergenic
regions YKF1016 fusion between intergenic
regions interchromosomal segmental
duplications YKF1114 out of frame fusion between
YJR090c and YOR267c truncated protein YKF1085 fu
sion between LTRs YKF1246 fusion between
LTRs YKF1122 fusion between LTRs YKF1027 fusion
between intergenic regions
30
single gene deletion mutant reduced
fitness initial genetic complexity
original strain, wild-type fitness initial
genetic complexity
spontaneous events 10-9 / generation / cell
offspring of mutant restored fitness, compete out
its parent increased genetic complexity (up to
300 genes simultaneously duplicated as a single
segment)
31
TANDEM GENE REPEAT FORMATION
32
Well known cases of gene tandems a and b
globin genes
pseudogenes
33
(No Transcript)
34
Tandem repeat arrays in Yeasts
D. Hansenii chromosome K
Amino-acid sequence identity between copies
from 82 to 95
35
TANDEM REPEATS IN C. glabrata
CAGL0C03894g
CAGL0C03960g
CAGL0C04026g
CAGL0C04136g
CAGL0C03850g
CAGL0C03916g
CAGL0C03982g
CAGL0C04048g
CAGL0C04114g
CAGL0C03828g
CAGL0C03872g
CAGL0C03938g
CAGL0C04004g
CAGL0C04092g
similar to SACE
YIL009ca
YIL010w
YIL011w
YDR007w
YNL031c
YNL030w
Homologous to YIL014w (MNT3) alpha-1,
3-mannosyltransferases responsible for adding the
terminal mannose residues of O-linked
oligosaccharides
CAGL0E01793g
CAGL0E01859g
CAGL0E01705g
CAGL0E01771g
CAGL0E01837g
CAGL0E01903g
CAGL0E01683g
CAGL0E01881g
CAGL0E01727g
CAGL0E01749g
CAGL0E01815g
CAGL0E01925g
YOL128c
YOL126c
YOL125w
YOL124c
Homologous to YLR120c , YLR121c or YDR144c,
Aspartic preoteases
A. Thierry and B. Dujon, unpublished
36
TANDEM REPEATS IN C. glabrata
CAGL0C03894g
CAGL0C03916g
CAGL0C03938g
CAGL0C03960g
CAGL0C03982g
CAGL0C04004g
CAGL0C04026g
CAGL0C04048g
51
75
81
76
60
59
59
78
50
63
56
64
20 40
60 80
100 120 1
ACTCTTATACACCTAGTACCCGATCGCTTCTGTCAACGTCCCCGCTCGGT
TACTGTGCATTCCTAACCCCCACAGATACAATGACTACAGCAATACTTCC
ACAACCACTTATCTCACTTCAGAAA 125


4302
ACTCTTATACACCTAGTACCCGATCGCTTCTGTCAACGTCCCCGCTCGGT
TACTGTGCATTCCTAACCCCCACAGATACAATGACTACAGCAATACTTCC
ACAACCACTTATCTCACTTCAGAAA 4426
4320 4340
4360 4380 4400
4420 140
160 180 200
220 240
126 TGCTCTCATAACACTTTCCCGCCAGCAATCTCTCACTACC
ACAACACCCTTCCCATTGTTCCCTCGAGACTCACGCTGGCAGATCGCTTT
CGGTAAATCCTTTGTAAACTAACTTTTTCACCAGG 250


4427
TGCTCTCATAACACTTTCCCGCCAGCAATCTCTCACTACCACAACACCCT
TCCCATTGTTCCCTCGAGACTCACGCTGGCAGATCGCTTTCGGTAAATCC
TTTGTAAACTAACTTTTTCACCAGG 4551
4440 4460 4480
4500 4520
4540 260
280 300
251 GTCTGCGCTGTTTCTCTGGCAA
CCTCGAGGACTCCCGTCGACTGGTGATGTGCGATAAAGCTGCCC


4552 GTCTGCGCTGTTTCTCTGGCAACCTCGAGGACTCCCGTC
GACTGGTGATGTGAGATAAAGCTGTCC 4560
4580 4600
4620
A. Thierry and B. Dujon, unpublished
37
EVOLUTION WITHIN THE ORTHOLOGOUS ALCOHOL
DESHYDROGENASE GENE CLUSTER
Expansion in the chicken lineage
Expansion in the human lineage
Hillier et al. Nature (2004) 432 695-716
38
DISPERSED (SINGLE) GENE DUPLICATIONS (RETROGENES)
39
FORMATION OF RETROGENES AND PROCESSED
PSEUDOGENES
40
ORIGINAL DISCOVERY OF RETROPOSONS
Yeast genome Ty elements (transposons of
yeast)
variable position in genome between strains,
mutagenic
experiment galactose induction selection of
his mutants (reactivation of promoter-less
gene) molecular analysis of integrated transposon
Presence of molecular tag Loss of intron
41
Single gene duplications in S. cerevisiae
Anecdotal observations ACP1 Hansche et al.,
(1978) Genetics 88, 673-687 HIS4 Greer and Fink,
(1979) PNAS 76, 4006-4010 ADH2 Paquin et al.,
(1992) Genetics 130, 263-271 HXTx Brown et al.,
(1998) Mol. Biol. Evol. 15, 931-942
10-10 - 10-12 duplication / cell / generation
recent experimental demonstration
42
Ty-mediated gene duplication
Schacherer et al. (2004) Genome Res. 14, 1291-1297
GATase glutamine amidotransferase CPSase
carbamoylphosphate synthetase DHOase
dihydro-orotase ATCase aspartate transcarbamylase
Haploid strain, select Ura prototroph ca.
10-10 event / cell / generation 1- Insertion
of Ty1 upstream of ATCase Roelants et
al., (1997) Mol. Gen. Genet. 246, 767-773 2-
Deletion of the GATase, CPSase mutated region
Welcker et al., (2000) Genetics 156,
549-557 (RAD52-dependent) 3- Duplication of
the ATCase coding sequence elsewhere in the
genome Bach et al., (1995) Yeast 11,
169-177
43
Ty-mediated gene duplication
Schacherer et al. (2004) Genome Res. 14, 1291-1297
Interchromosmal events 3 Intrachromosmal events
1
Spontaneous events
44
Ty-mediated gene duplication
Schacherer et al. (2004) Genome Res. 14, 1291-1297
polyA tails microhomology regions between TyA
and URA2
Accidental incorporation of URA mRNA in
Ty-VLP Reverse transcription of URA3
mRNA Template switch onto Ty-RNA Integration of
cDNA
45
Increases polymorphism
Sequence divergence
Increases redundancy
Decreases redundancy
Duplications
Gene loss
Genetic drift, selection
Decreases polymorphism
46
GENE LOSS
47
GENE RELICS
48
Average sequence identity between relic and gene
62 (1127 / 1818)
49
Distribution of gene relics on the S. cerevisiae
genomic map
50
Species-specific gene loss
Criterion a protein family represented in all
yeast species but one
Lost from K. lactis YGL156w Carbohydrate
metabolism YML005w Unclassified
proteins YPL207w Unclassified proteins YPR147c U
nclassified proteins
Lost from C. glabrata YBR018c Carbohydrate
metabolism YBR019c Carbohydrate
metabolism YBR020w Carbohydrate
metabolism YDR009w Carbohydrate
metabolism YIL162w Carbohydrate
metabolism YNR071c Carbohydrate
metabolism YMR096w Cell cycle and DNA
processing YFL059w Cell rescue, defense and
virulence YLL057c Cell rescue, defense and
virulence YNL333w Cell rescue, defense and
virulence YBR296c Homeostasis of cations
YLR189c Lipid, fatty-acid and isoprenoid
metabolism YGR286c Metabolism of vitamins,
cofactors, and prosthetic groups YIR027c Nitrogen
and sulfur metabolism YIR029w Nitrogen and
sulfur metabolism YIR032c Nitrogen and sulfur
metabolism YPR194c Oligopeptide Transporter
YJL212c Pheromone response, mating-type
determination, sex-specific proteins
YAR071w Phosphase metabolism YBR092c Phosphase
metabolism YBR093c Phosphase metabolism YHR215w
Phosphase metabolism YDR104c Sporulation and
germination YOR313c Sporulation and
germination YMR283c tRNA modification YJL100w Un
classified proteins YMR321c Unclassified
proteins YOR129c Unclassified proteins YPL273w U
nclassified proteins
Lost from Y. lipolytica YJL094c Cation
transporteurs YBR238c Cell cycle YDR082w Cell
cycle YBR131w Cell rescue, defense and
virulence YIL150c DNA processing YDL200c DNA
recombination and DNA repair YPL057c Fungal cell
differentiation YCR020c mRNA transcription YLR06
7c Protein synthesis YMR257c Protein
synthesis YNL284c Protein synthesis YML111w Prot
eolytic degradation YMR275c Proteolytic
degradation YBL014c rRNA transcription YML043c r
RNA transcription YER132c Sporulation and
germination YGL197w Sporulation and
germination YHR184w Sporulation and
germination YLR139c Transcription YBR163w Unclas
sified proteins YDR131c Unclassified
proteins YDR367w Unclassified proteins YEL001c U
nclassified proteins YER004w Unclassified
proteins YER077c Unclassified proteins YFR013w U
nclassified proteins YGL107c Unclassified
proteins YGR134w Unclassified proteins YHR029c U
nclassified proteins YJL149w Unclassified
proteins YJR003c Unclassified proteins YJR003c U
nclassified proteins YJR111c Unclassified
proteins YLL033w Unclassified proteins YLR320w U
nclassified proteins YNR068c Unclassified
proteins YNR069c Unclassified proteins YOL017w U
nclassified proteins YOR060c Unclassified
proteins YPL005w Unclassified proteins
Lost from D. hansenii YFR018c Amino acid
metabolism YEL023c Cell growth and
morphogenesis YCR014c DNA recombination and DNA
repair YJL132w Lipid, fatty-acid and isoprenoid
metabolism YBR227c Proteolytic
degradation YMR265c Unclassified
proteins YNL187w Unclassified proteins YPR002w U
nclassified proteins
51
MORE TO THE EVOLUTIONARY DYNAMICS HGT and NUMTs
52
Possible cases of horizontal gene transfer
Species-specific genes (in yeasts) with homologs
in Bacteria
Sp
ec
i
es
Ge
n
e
n
a
m
e
H
omo
l
og
Sp
ec
i
es
Fun
ct
ion
A
c
c. N

K
LL
A
0
C
092
1
8g
Q8
PP
U
9
X
an
t
ho
m
ona
s
axo
n
opod
is
C
on
s
e
rv
ed
g
l
yox
a
l
a
s
e d
o
ma
i
n p
r
ote
i
n
K. lactis
K
LL
A
0
A
02431
g
Q8
E
G95
S
he
w
an
e
l
l
a

one
i
de
nsis
Hy
pot
h
et
ic
a
l
p
r
ote
i
n
K
LL
A
0
A
12089
g
P
2134
0
B
a
cill
u
s s
ubt
ilis
ne
g
at
iv
e r
e
gu
l
ato
ry
pr
o
te
i
n, a
cetyl
l
tr
a
n
s
fer
as
e do
m
a
i
n
D. hansenii
DE
H
A
0
B
15
7
63g
Q8
Z
I
B
2
B
a
cill
u
s c
er
e
u
s
p
r
ote
i
n
y
d
hR
pre
cu
r
s
or
Y. lipolytica
Y
AL
I
0F0
4
290g
Q98
7
V
4
R
h
iz
ob
i
u
m l
ot
i
D
-a
mi
no p
e
pt
i
da
s
e
Y
AL
I
0F0
5
654g
Q8
EA
T4
S
he
w
an
e
l
l
a

one
i
de
nsis
C
on
s
e
rv
ed
hy
pothet
ica
l

prot
ei
n
Y
AL
I
0F3
1
867g
Q9I
5
L7
Ps
eudo
m
ona
s aeruginosa
C
on
s
e
rv
ed
hy
pothet
ica
l

prot
ei
n
Y
AL
I
0E
3
3011
g
P
4590
0
B
a
cill
u
s s
ubt
ilis
C
on
s
e
rv
ed
hy
pothet
ica
l

prot
ei
n, ade
nyl
ate
ki
na
se
fam
ily
Summary of HGT C. glabrata none K. lactis 5
genes (including a pair of paralogs) D.
hansenii 1 gene Y. lipolytica 8 genes
(including two pairs of paralogs)
53
NUMTS in the genome of S. cerevisiae
Ricchetti et al., Nature (1999) 402 96-100
54
Transfer of mitochondrial DNA to the
nucleus experimental design
Ricchetti et al., (1999) Nature 402, 96-100
55
Experimental design
Repaired yeast chromosome
ura- colonies
?
PCR amplifications
Chromosome repaired by non-homologous end-joining
short PCR fragments
Chromosome repaired with insertion of novel DNA
fragment
sequenced
?
long PCR fragments
56
?
------------ATTACCCTGTTAT
CAGGGTAAT----------
3'
------------TAATGGGAC
TATTGTCCCATTA----------
3'
57
(No Transcript)
58
A flux of mitochondrial DNA sequences to the
nucleus
Fragmentation of mtDNA Transfer into the nucleus
(?) Integration into chromosomes following
double-strand break
59
Numts in the human nuclear genome
Ricchetti, Tekaia, Dujon (2004) PLOS 2(9) E273
211 numts in the human genome 93 are
insertions of single DNA fragments, 7 are
insertions of multiple, non-adjacent mtDNA
fragment numts size range 47 - 14654 bp and
78-100 identity to mtDNA.
PCR amplification on DNA from 21 human donors and
3 chimpanzees (Pan troglodytes) using either one
primer in the nuclear sequence and one in the
numts sequence or two primers in the nuclear
sequence some PCR fragments were directly
sequenced for verification.
Results 10 numts common to H. sapiens and
P.troglodytes present in all human individuals
tested -----gt ancient 21 numts specific to H.
sapiens and present in all 21 individuals
tested 6 numts specific to H. sapiens but
present in some individuals only
fixation of one novel numt per 200 000 years in
human lineage
Conclusion 27 insertions have occured in the
human genome since its separation from Pt 6 of
them are not fixed in the human population
60
numts insertion and human genetic diseases
Turner et al., (2003) Human Genet. 112, 303-309
16 year old boy with sporadic case of
Pallister-Hall syndrome (anomalous
development polydactyly, metacarpal fusion,
hypothalamic hamartoma, bifid epiglotis)
72 bp insertional mutation in exon 14 of GLI3
gene sequence identical to fragment of mtDNA
(fragment of ser-tRNA - leu tRNA genes) sequence
predicts a truncated protein (935 aa compared to
1580 aa for w.t.) functional disruption of a key
developmental gene
conception of patient temporally and
geographically associated with high-level
radioactive contamination following the Chernobyl
accident
Borensztajn et al., (2002) Brit. J. Haematol.
117, 168-171 family case of 251 bp mitDNA
fragment inserted into coagulation factor VII
gene Willett-Brozick et al., (2001) Human Genet.
109, 216-223 germline insertion of a 41 bp
mtDNA fragment (12S rRNA) associated with a
balanced translocation (t(911)(p24q23)) of
uncertain clinical significance, founder of
mutation unknown.
61
SOME CONCLUSIONS AND PERPECTIVES
62
Eucaryotic genome evolution represents a dynamic
equilibrium between 1- duplications
and loss of genes
consequences 1 -formation of paralogs with
possibility of neo-functionalization (acquisition
of novel function) or subfunctionalization
(specialization of function between members of a
family) 2 -gene family expansion and
reduction 3- change of genetic maps (loss of
synteny)
2- divergence of sequences (creation of alleles,
polymorphism of population) and loss of
divergence (genetic drift and selection)
consequences formation of pseudogenes
(non-processed, disabled genes)
3- activity and elimination of transposable
elements
consequences duplication of genes or fragments
(domain accretion) change of genetic maps
(chromosome reanrragements) formation of
retrogenes and processed pseudogenes
4- possible acquisition of external sequences
(HGT) or internal sequences (NUMTs)
consequences acquisition of novel functions
(selection) or gene inactivation
5- what about non-coding RNA genes ?
63
The central dogma of molecular biology
Replication
DNA
Transcription
RNA
Translation
Proteins
64
Variability of rDNA
type loci chr. S. cerevisiae 1 1 1 internal C.
glabrata 1 2 2 subtel K. lactis 1 1 1 internal
D. hansenii 3 3 3 subtel 1 orphan unit Y.
lipolytica gt9 7 4 subtel several orphan
units 105 copies 5S dispersed
65
VARIABILITY OF NON-CODING RNA GENES IN YEASTS AND
VERTEBRATES
SACE CAGL KLLA DEHA YALI Total tRNA
genes 274 207 162 205 510 (co-transcribed tRNA
gene pairs) (4) (0) (2) (17) (11) Splicing
RNA U1 1 1 1 1 2 U2 1 1 1 1 1 U4 1 1 1 2 1
U5 1 1 1 1 1 U6 1 1 1 1 1 Processing
U3 1 1 1 2 3 Rnase P 1 1 1 1 1 Protein
transport (SRP) 1 1 1 1 2 Telomerase 1 1 1 nd
nd
HILLIET et al. Nature (2004) 432 695-716
66
The Génolevures Sequencing Consortium (GDR 2354
CNRS )
and UMR8030 CNRS, Evry J. Weissenbach,
V. Anthouard, V. Barbe, L. Cattolico, S. Oztas,
C. Scarpelli, P. Wincker Génopole Institut
Pasteur, Paris C. Bouchier, L. Frangeul, L.
Ma LaBRI (UMR5800 CNRS), Centre de
bioinformatique and IBGC (UMR5095 CNRS), Univ.
Victor Segalen, Bordeaux D. Sherman, E. Beyne,
I. Lesur, M. Nikolski, H. Ferry-Dumazet, A.
Groppi A. de Daruvar, N. Goffard M. Aigle, P.
Durrens Dynamique, évolution et expression des
génomes de microorganismes (FRE2326 CNRS), Univ.
Louis Pasteur, Strasbourg J-L. Souciet, S.
Potier, C. Bleykasten, J. de Montigny, L.
Despons, N. Jauniaux, M-L. Straub, B. Wirth, M.
Zeniou-Meyer Unité de Génétique moléculaire des
levures, (URA2171 CNRS, and Univ. P. M. Curie),
Institut Pasteur , Paris B. Dujon , J. Boyer,
E. Fabre, C. Fairhead, G. Fischer, C. Hennequin,
A. Kerrest, R. Koszul, I. Lafontaine, H.
Muller, O. Ozier-Kalogeropoulos, S. Pellenz,
G-F. Richard, E. Talla, F. Tekaia, A.
Thierry CLIB and Génétique moléculaire et
cellulaire (UMR216 INRA and URA1925 CNRS),
Institut National Agronomique, Grignon C.
Gaillardin, A. Babour, S. Barnay, J-M.
Beckerich, S. Blanchin, A. Boisramé, S.
Casaregola, P. Joyet, C. Neuvéglise, J-M. Nicaud,
A. Suleau, D. Swennene Institut de Génétique
moléculaire (UMR8621 CNRS), Univ. Paris-Sud,
Orsay M. Bolotin-Fukuhara, F. Confanioleri, I.
Zivanovic Génétique des levures, (UMR5122
CNRS), Univ. Claude Bernard, Lyon M.
Wésolowski-Louvel, M. Lemaire IBMC (UPR9002
CNRS), Strasbourg
E. Westhof, R.
Kachouri Logiciels et banques de données,
Institut Pasteur, Paris B.
Caudron Biochimie et Génétique moléculaire CEA,
Saclay C. Marck Interactions
macromoléculaires (URA2171 CNRS), Institut
Pasteur, Paris F. Hantraye
About PowerShow.com