Title: Queenworker caste determination and kin conflict over caste fate
1Queen-worker caste determinationand kin
conflict over caste fate
2Lecture 5 Aims
- To discuss how differential gene expression
underlies queen-worker caste determination in the
social Hymenoptera. This is central to understand
how variation in gene expression underlies
adaptive phenotypic variation. - To set out the basic predictions of kin conflict
over caste determination for the social
Hymenoptera. - To examine whether the predictions of the theory
are met in nature (i.e. stingless bees).
3Lecture 5 Outline
- Queen-worker caste determination. Alternative
phenotypes - Evolution of polyphenisms
- Association between queen-worker caste
determination and differential gene expression in
the social Hymenoptera. - Polistes canadensis (paper wasp)
- Bombus terrestris (bumblebee)
- Apis mellifera (honeybee).
- Kin conflict over caste determination for the
social Hymenoptera. - Test of caste determination
- Melipona (stinglessbee).
4Queen-Worker Caste Determination
- The evolution of sterile castes in the social
insects represents one of the major transitions
in evolution.
- The worker caste is entirely female and, like
queen caste, arises from fertilized, diploid eggs.
- Caste determination refers to the process by
which a totipotent, female individual (capable of
becoming a member of either caste) develops into
an adult queen or worker.
5Queens Workers
Queens are morphologically, physiologically and
behaviourally specialized for egg-laying.
- Workers are specialized for helping and either
lack ovaries or, if they have them, usually lack
a sperm receptacle and are unable to mate and
produce haploid offspring.
6Differential expression of genes
- With few exceptions, whether female larvae
develop into queens or workers depends NOT on
genetic differences but on their environment at
critical periods of caste determination.
- Caste determination and differentiation must
involve the differential expression of genes
shared by queens and workers.
- Social Hymenoptera present a unique opportunity
to investigate how variation in gene expression
underlies adaptive morphological and behavioural
diversity.
7Complex Castes Systems
- Morphological
- Permanent
- Determined as larva (royal jelly)
- The identity of differentially expressed genes
associated with queen-worker caste determination
in larvae has only been investigated in the
advanced social honeybee Apis mellifera.(Evans
Wheeler 1999, 2000) - Genes associated with caste determination in the
honey bee are irreversibly switched on/off
8Simple Caste Systems
- Morphologically identical
- Behavioural roles
- Flexible, reversible
- Determined during adulthood
- Differential gene expression?
9Evolutionary Origin of Castes
- Complex societies evolve from simple ones
Bumble Bee Pereboom et al. submitted
Honey Bee Evans Wheeler 99
10Important questions
- 1) Are behavioural castes associated with
differential gene expression? - 2) How do patterns of expression differ in
simple and complex castes?
11Finding Genes Subtractive Hybridization
Q
Enrich Normalise
W
CGCTACGGTATTTTTCAGCTTCGTTAACCATTCTCTCAATATCTTCCTTG
CTAAGACGTCCCTTATCGTTGGTAATAGTGATTT
Y
BLAST
12Methods Microarrays
Q
W
Y
Genetic array showing genes expressed
differentially by honeybee workers and queens
during caste determination
13Simple Caste System
- Paper wasp - Polistes canadensis
- Behavioural castes
- Tropical no seasonal constraints
- All young females totipotent
14Ontogeny of P. canadensis
Age
15Results
- 1) Are behavioural castes associated with
differential gene expression? - 2) How do patterns of expression differ in
simple and complex castes?
16Results 1 Shared Expression Levels
(n39 genes)
7
Queens and young females in Polistes have
discrete genes, but workers are intermediates
17Expression patterns of individual genes
Some genes are upregulated (showing relatively
higher levels of expression) in queens and some
are downregulated
18Single pathway to queenhood
- Behavioural castes are associated with
differential gene expression along a single
pathway to queenhood.
Young
Workers
Queens
19Conclusions 1
- Are behavioural castes associated with
differential gene expression? - Yes!
- Single genomic pathway to queenhood
- Workers are genomic intermediates
20- 1) Are behavioural castes associated with
differential gene expression? - 2) How do patterns of expression differ in
simple and complex castes?
21From Simple to Complex Castes
Simple
Paper wasps Sumner et al unpublished
- Single pathway
- Temporal segregation of gene expression within
genome
Bumble Bee Pereboom et al. sub
- Caste-specific gene allocation within
- genome
- Distinct queen/worker pathways
Honey Bee Evans Wheeler 99
Complex
22Conclusions gene expression/caste determination
- Social Hymenoptera represent excellent systems to
investigate how variation in gene expression
underlies adaptive morphological and behavioural
diversity.
- Caste evolution associated with
- temporal separation within genome
- caste-specific allocation of genes
- Comparative studies of caste-related gene
expression provide essential insights into the
nature, origin and evolution of caste polyphenism
in social insects. - But, these are early days!
- Natural History genomics
Single queen-rearing cell
23Why become a worker?
Workers Give up reproduction for the benefit of
their mother queen
Darwinian puzzle The sterile worker caste of
the social Hymenoptera poses one special
difficulty, which at first appeared to me
insuperable, and actually fatal to my whole
theory. Darwin (1859) On the Origin of Species
24Kin conflict over Caste Determination
- benefit of becoming a queen gaining greater
direct reproduction - SO WHY DO NOT MANY FEMALES OPT TO BECOME QUEENS?
- females benefit from becoming a queen, BUT colony
would suffer if all would do so
caste fate conflict - individual benefits but collective suffers
tragedy of the commons
Bourke and Ratnieks 1999. Kin conflict over caste
determination in social Hymenoptera. Behavioural
Ecology and Sociobiology 46 287-297.
25Tragedy of the commons
- Each individual gains by pursuing interests that
increase returns relative to neighbours but
decrease the value of the common goods. If all
succumb to the temptation of free-riding, the
outcome is a collective disaster. William
Forster Lloyd 1832
26Overgrazing
27Socially controlled, Caste fate enforced
- In many social insects females are unable to
choose their own caste since their fate is
determined by the quantity and quality of the
food they receive from the adult workers
nutritional caste determination. - For instance queen rearing in honeybees (royal
jelly)
28 Exception Melipona stingless bees
- In Melipona stingless bees conditions for actual
caste conflict are met
- Queens and sexuals are reared simultaneously
- Immature female individuals can potentially
control their own caste fate because queens and
workers are similar in size self-determination
29 ...in fact queens are slightly smaller
Melipona beecheii
mean 57.1 mg
F3,48076.3, p lt 1E-13
mean 48.2 mg
gt66.1 mg
lt26.6 mg
30 Develop in cells of uniform size
31Mass-provisioning
- Female larvae have practical power over their own
nutrition because they are provisioned by workers
with food and the cell in which they develop is
then sealed.
32Predictions
- The theory of kin-selected caste conflict
predicts - More queens should emerge than are favoured by
the workers, due to female larvae selfishly
developing as queens
- It likewise predicts worker actions to correct
the excess of queens.
These predictions are fulfilled by Melipona
Bourke and Ratnieks 1999. Kin conflict over caste
determination in social Hymenoptera. Behavioural
Ecology and Sociobiology 46 287-297.
33Melipona supports predictionexcess queens
Queen production in Melipona is characterized by
the emergence of a vast excess of queens ( up to
25, of diploid larvae emerge as queens).
A piece of uncapped comb of Melipona subnitida
reveals that queens are produced in excess
34Large-scale cull of queens by workers
A Melipona subnitida queen ecloses from her cell
Immediately afterwards, the workers aggress and
kill the queen.
Finally, the workers dump the dead queen corpse
and leave it to decompose in the colony. The fact
that queens are killed by the workers shows they
are produced in excess.
35Reproduction by fission
- A factor that probably aggravates this phenomenon
is that stingless bees reproduce by colony
fission. - The colony, which in most species is monogynous,
divides into two, with each new colony headed by
a young queen produced in the mother colony.
- Therefore only a handful of new queens is
required for colony reproduction per fission
event, making the unnecessary excess of queens
that emerges likely to represent a significant
cost to the colony.
36 What about other social insects?
- other swarming social insects
- Honey bees
- trigonine stingless bees
- Relatively large degree of queen-worker size
dimorphism - Queens develop in cells larger than those for
workers
- caste fate enforced via food control. Lack
self-determination
- Consistent with this in these species there is no
large-scale overproduction of queens and hence no
cull of excess queens.
37Alternative explanations for excess queen
production in Melipona ?
Other explanations
- Insurance against queen loss
- queen overproduction is far too high
- queen replacement takes 10 days (in this period
up to 70 queens are produced)
- Or a mechanism that allows workers to have a
stock of queens from which to select the most
fecund
38Conditions for actual caste conflict
- Small queen-worker dimorphism
- Simultaneous rearing of queens and workers
- Self-determination Developing female larvae have
some practical control over own nutrition
- Reproduction by colony fission (because excess of
queens will be costly to colony, and will
therefore be likely to be culled)
39 Summary
- Social insect caste system provides scope for
conflict - Social insect females benefit from developing as
a queen - Melipona females selfishly exploit colony by
developing as queens (self determination)
- results in tragedy of the commons queen
overproduction - what limits exploitation within the group?
40Costs to kin can limit exploitation
- Exploitation becomes less profitable when
selfishness causes cost to kin - Queen overproduction causes depletion of
workforce and has two costs to kin - reduced ability to swarm
- reduced production of males
- Prediction less exploitation when group members
are highly related reduced exploitation.
Hypothesis never tested
41What can we learn from all this?
42Insight into conflict resolution
Efficient Society but No Individual Freedom
Individual Freedom Causes a Cost to Society