siRNA Data Collection and Analysis PowerPoint PPT Presentation

presentation player overlay
About This Presentation
Transcript and Presenter's Notes

Title: siRNA Data Collection and Analysis


1
siRNA Data Collection and Analysis
  • Blake Adams
  • CS 6985
  • 12/08/2004

2
Overview
  • What is RNA silencing?
  • Data Collection
  • Data Extraction
  • Articles of Interest
  • siRNA scoring technique
  • siRNA scoring program
  • Some results
  • Conclusion

3
How RNA Interference (RNAi Silencing) Works
  • Inhibiting the expression of individual genes by
    interfering with a mRNA being transcribed.
  • This is done vai a small double-stranded RNA.  
    An enzyme named DICER snips short interfering
    RNAs (siRNA) from longer doublestranded RNAs
    made by (A) self-copying gene sequences,  (B) by
    replicating viruses, or (C) regulatory RNA
    sequences known asmicroRNAs.   All the RNAs (A,
    B, C) are cleaved by DICER enzyme into short
    siRNA pieces that can suppress gene expression. 

4
Data Collection/Extraction
  • EBSCO Host
  • MEDLINE Database
  • Search criteria siRNA
  • Satisfactory articles were read and scanned for
    siRNA used during the research.

5
Binding of mouse VL30 retrotransposon RNA to
PSFprotein induces genes repressed by PSF
Effectson steroidogenesis and oncogenesis
  • Retrotransposon - A transposon copied from RNA
    with the use of reverse transcript.
  • Steroidogenesis - Production of steroids by
    living organisms.
  • Oncogenesis - The progression of cytological,
    genetic, and cellular changes that culminate in a
    malignant tumor.
  • Hypothisis Steroidogenesis is damaged or
    surpressed in mammals with cancer. Evidence
    suggests VL30 RNA and PSF protein control the
    process of steroidogenesis.
  • What happened? Introduction of siRNA activated
    steroid synthesis in the mice with adrenal gland
    tumors.
  • What does this mean? This solidifies the
    evidence that VL30 RNA and PSF regulates
    steroidogenesis, further evidence suggests that
    the same is true of humans. If true, we may be
    reaching a better understanding of the process of
    steroidogenesis at a genetic level.

6
Transfection of naked siRNA results in
endosomal uptake and metabolic impairment in
cultured neurons
  • Transfection - Infection of a cell with purified
    viral nucleic acid, resulting in subsequent
    replication of the virus in the cell.
  • naked siRNA introduction of siRNA to a system
    without the assistance of any sort of delivery or
    calalyst mechanism.
  • Hypothesis siRNA delivery to primary neuron
    cultures is possible without the use of cationic
    lipids or other transfection agents.
  • What happened? While the siRNA worked its way
    into the cells, it showed little to no presence
    within the nucleus of the cells. siRNA presence
    in the cell suggests silencing should have
    occurred within the cells but none was observed.

7
Functional inhibition of the p75 receptor using a
small interfering RNA
  • P75 mediates a wide variety of biological
    effects. Contributes to the inhibition of neuron
    regeneration and the death of neurons
  • Hypothisis knocking down the expression of
    p75NTR is possible with siRNA, doing so may have
    useful applications a therapeutic agent.
  • What happened? Knocked down the expression of
    p75NTR, however the effects on test subject
    varied depending on the subject.

8
An algorithm for design of functional siRNA
  • An algorithm for selection of functional siRNA
    sequences. - Mohammed Amarzguioui
  • Manual - An algorithm for design of functional
    siRNA - Mohammed Amarzguioui
  • Selection rules based entirely on consideration
    of the sequence of the siRNA
  • MAJOR FACTORS
  • Duplex GC content within the range of 31.6 57.9
  • A/U differential of the three terminal base-pairs
    at either end of the duplex exhibiting a higher
    A/U content at the 3 end, lower at the 5 end.
    (relative to the sense strand)
  • Minor Positive Determinants
  • G or C at the 1 position
  • A or U at the last position
  • A at the 6 position
  • Minor Negative Determinants
  • U at the 1 position
  • G at the end position

9
Programmatic Implementation
  • Perl
  • Takes sense and antisense as entry from user
  • Duplex G/C content between 31.6 57.9
    2
  • A/U Differential in first 3 and last 3 of DUPLEX
    favors 3 end of SENSE 2
  • G or C at the 1 position of sense 1
  • G or C at the 1 position of antisense 1
  • A or U at the end position of sense 1
  • A or U at the end position of antisense 1
  • A at the 6 position of sense 1
  • A at the 6 position of antisense 1
  • U at the 1 position of sense -1
  • U at the 1 position of antisense -1
  • G at the end position of sense -1
  • G at the end position of antisense -1

10
Some Results
  • mVL30
  • Sense GACGCCAGGAACAAUUAAG
  • AntisenseCUUAAUUCUUCCUGGCGUC
  • GC Content 0.47 2
  • A/U Differential 0 (5 AUU, 3 AAU) 0
  • G at 1 pos (sense) 1
  • C at 1 pos (antisense) 1
  • G at end pos (sense) -1
  • FINAL SCORE 3

11
Some Results
  • EGFP
  • Sense GACGUAAACGGCCACAAGUUC
  • Antisense
  • CGCUGCAUUUGCCGGUGUUCA
  • GC Content 0.54 2
  • A/U Differential 3 (5 A, 3 UUU_A) 2
  • G at 1 pos (sense) 1
  • C at 1 pos (antisense) 1
  • A at 6 pos (sense) 1
  • A at end pos (antisense) 1
  • FINAL SCORE 8
  • Cdc42
  • Sense GUAGUCUGUCAUAAUCCUCUU
  • Antisense
  • GAGGAUUAUGACAGACUACUU
  • GC Content 0.38 2
  • A/U Differential 1 (5 UAA, 3 UUUU) 2
  • G at 1 pos (sense) 1
  • G at 1 pos (antisense) 1
  • U at end pos (sense) 1
  • U at end pos (antisen) 1
  • FINAL SCORE 8

12
Some Results
  • p75NTR
  • Sense GGAGACAUGUUCCACAGGCAU
  • AntisenseCCUCUGUACAAGGUGUCCGUA
  • GC Content 0.52 2
  • A/U Differential 2 (5 AU, 3 AUUA) 2
  • G at 1 pos (sense) 1
  • C at 1 pos (antisense) 1
  • U at end pos (sense) 1
  • A at end pos (antisense) 1
  • FINAL SCORE 8
Write a Comment
User Comments (0)
About PowerShow.com