DNA%20and%20a%20little%20more%20Ivar%20Giaever%20Rensselaer%20Polytechnic%20Institute%20and%20Applied%20BioPhysics,%20Inc.%20Troy,%20NY%2012180%20and%20Oslo%20Universitetet%20Blindern,%20Oslo - PowerPoint PPT Presentation

View by Category
About This Presentation
Title:

DNA%20and%20a%20little%20more%20Ivar%20Giaever%20Rensselaer%20Polytechnic%20Institute%20and%20Applied%20BioPhysics,%20Inc.%20Troy,%20NY%2012180%20and%20Oslo%20Universitetet%20Blindern,%20Oslo

Description:

... at Sun Microsystem, worries in the magazine WIRED about the 'gray goo', how ... is not between various species but between DNA sequences, the lucky ones survive. ... – PowerPoint PPT presentation

Number of Views:36
Avg rating:3.0/5.0

less

Write a Comment
User Comments (0)
Transcript and Presenter's Notes

Title: DNA%20and%20a%20little%20more%20Ivar%20Giaever%20Rensselaer%20Polytechnic%20Institute%20and%20Applied%20BioPhysics,%20Inc.%20Troy,%20NY%2012180%20and%20Oslo%20Universitetet%20Blindern,%20Oslo


1
DNA and a little moreIvar GiaeverRensselaer
Polytechnic InstituteandApplied BioPhysics,
Inc.Troy, NY 12180andOslo Universitetet
Blindern, Oslo
2
(No Transcript)
3
Cloning
Cloning is not a very precise term. It used to
mean take DNA from an adult cell, now when you
read about it, stem cells are often used.

4
Some plants are easy to clone, for example
potatoes. McIntosh apples are grafts from ONE
Canadian tree
5
(No Transcript)
6
Nobel Prize 1962
Francis Crick 1916-
Jim Watson 1928-
7
On April 25, 1953, Crick and Watson published
in Nature the famous paper "Molecular Structure
of Nucleic Acids
Now know as The Double Helix
8
(No Transcript)
9
The length of DNA in each cell is 1 meter.
A person has 1014 cells. The
length of DNA in a single person1014 m Distance
to moon is 108 m, to the sun 1011 m and to
nearest star 1016 m
10
Probably the most famous sentence in science It
has not escaped our notice that the specific
pairing we have postulated
immediately suggests a possible copying mechanism
for the genetic material"
11
Please note that there are no small men who put
the parts together, it happens all by random
diffusion. It is a self organizing system
12
K. Eric Drexler describes the assembler
An assembler can make everything, atom by
atom, including making a copy of itself
Bill Joy, founder and chief s scientist at Sun
Microsystem, worries in the magazine WIRED
about the gray goo, how robots could ravage the
earth
Cells are such machines, cells have ravaged the
earth, changed the atmosphere to contain oxygen,
and put green goo all over the surface
e.coli
13
(No Transcript)
14
Can we make cars this way?
Big box full of parts that fit into each other.
Shake it vigorously and..
Completed cars come out
15
Double stranded DNA from a small virus.
Individual molecules are not visible, and the
double helix appears as a long thread
16
The genome can be sequenced chemically
Bacteriophage phi-X174 Genome
GAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTG
ATGAGTCGAAAAATTATCTTGATAAAGCAGGAATTACTACTGCTTGTTTA
CGAATTAAATCGAAGTGGACTGCTGGCGGAAAATGAGAAAATTCGACCTA
TCCTTGCGCAGCTCGAGAAGCTCTTACTTTGCGACCTTTCGCCATCAACT
AACGATTCTGTCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATA
TGCTTGGCACGTTCGTCAAGGACTGGTTTAGATATGAGTCACATTTTGTT
CATGGTAGAGATTCTCTTGTTGACATTTTAAAAGAGCGTGGATTACTATC
TGAGTCCGATGCTGTTCAACCACTAATAGGTAAGAAATCATGAGTCAAGT
TACTGAACAATCCGTACGTTTCCAGACCGCTTTGGCCTCTATTAAGCTCA
TTCAGGCTTCTGCCGTTTTGGATTTAACCGAAGATGATTTCGATTTTCTG
ACGAGTAACAAAGTTTGGATTGCTACTGACCGCTCTCGTGCTCGTCGCTG
CGTTGAGGCTTGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCT
T THE SEQUENCE IS ALTOGETHER 5386 BASES (OR
LETTERS) LONG IT CONTAINS 10 GENES, I.E. THE
PHAGE MAKES 10 DIFFERENT PROTEINS TCCTGCTCCTGTTG
AGTTTATTGCTGCCGTCATTGCTTATTATGTTCATCCCGTCAACATTCAA
ACGGCCTGTCTCATCATGGAAGGCGCTGAATTTACGGAAAACATTATTAA
TGGCGTCGAGCGTCCGGTTAAAGCCGCTGAATTGTTCGCGTTTACCTTGC
GTGTACGCGCAGGAAACACTGACGTTCTTACTGACGCAGAAGAAAACGTG
CGTCAAAAATCACTTTATGCGGACACTTCCTACAGGTAGCGTTGACCCTA
ATTTTGGTCGTCGGGTACGCAATCGCCGCCAGTTAAATAGCTTGCAAAAT
ACGTGGCCTTATGGTTACAGTATGCCCATCGCAGTTCGCTACACGCAGGA
CGCTTTTTCACGTTCTGGTTGGTTGTGGCCTGTTGATGCTAAAGGTGAGC
CGCTTAAAGCTACCAGTTATATGGCTGTTGGTTTCTATGTGGCTAAATAC
GTTAACAAAAAGTCAGATATGGACCTTGCTGCTAAAGGTCTAGGAGCTAA
AGAATGGAACAACTCACTAAAAACCAAGCTGTCGCTACTTCCCAAGAAGC
TGTTCAGAATCAGAATGAGCCGCAACTTCGGGATGAAAATGCTCACAATG
ACAAATCTGTCCACGGAGTGCTTAATCCAACTTACCAAGCTGGGTTACGA
CGCGACGCCGTTCAACCAGATATTGAAGCAGAACGCAAAAAGAGAGATGA
GATTGAGGCTGGGAAAAGTTACTGTAGCCGACGTTTTGGCGGCGCAACCT
GTGACGACAAATCTGCTCAAATTTATGCGCGCTTCGATAAAAATGATTGG
CGTATCCAACCTGCA
17
(No Transcript)
18
(No Transcript)
19
(No Transcript)
20
(No Transcript)
21
(No Transcript)
22
(No Transcript)
23
Electrophoresis the most used method in biology
24
Restriction enzymes (Magic scissors)
Example of restriction sites
25
Everybody has a PERSONAL barcode
26
According to DNA analysis, OJs blood was all
over the crime scene and further more his finger
was cut. But the jury did not understand science
and he was found not guilty.
27
300.000 Generations since we split from
chimpanzees.
We are all descendants from a woman who lived in
Africa 10.000 generations ago
Women and men are not alike, no matter how much
we pretend that they are
You are not what you eat, you are shaped by your
genes, both physically and mentally
28
Survival of the fittest
Dinosaurs are extinct because they could not
compete.
Charles Darwin 1806-1889
The real competition is not between various
species but between DNA sequences, the lucky ones
survive.
About PowerShow.com