Random Design Building Bridges Between Science and Faith - PowerPoint PPT Presentation

Loading...

PPT – Random Design Building Bridges Between Science and Faith PowerPoint presentation | free to view - id: 24da33-ZDc1Z



Loading


The Adobe Flash plugin is needed to view this content

Get the plugin now

View by Category
About This Presentation
Title:

Random Design Building Bridges Between Science and Faith

Description:

Scientists are suspicious that Christians want to insert religious beliefs into science. Christians fear that science seeks to remove God from the picture altogether. ... – PowerPoint PPT presentation

Number of Views:35
Avg rating:3.0/5.0
Slides: 28
Provided by: pcre5
Category:

less

Write a Comment
User Comments (0)
Transcript and Presenter's Notes

Title: Random Design Building Bridges Between Science and Faith


1
Random DesignBuilding Bridges Between Science
and Faith
2
Higher Order Thinking in Biology Education
Language
Science
Communication
Culture
Mathematics
Music
Art
History
Religion
Information Science
Connecting the Dots
3
Higher Order in Biology Molecules to Mankind
4
  • Higher Order Thinking Requires
  • Openness/receptive to new dots
  • Acquisition of new Dots
  • Dots accurate and well-defined
  • Processing Time

5
Barriers to Higher Order Thinking
  • Limiting input of new dots
  • Misunderstanding dots
  • Focusing on wrong dots
  • Language and Communication
  • Personal
  • Community/Transferance

6
Language Problem!Modern Day Tower of Babel
  • Examples
  • Science
  • Evolution
  • Creationist
  • Random
  • Naturalism
  • Christian
  • Mutation
  • Emotional obstacles

7
Coming to Terms with TermsDefinitions of
Evolution
  • Evolution, change through time (generic)
  • Evolution, (genetic mechanisms and development)
  • Evolution, (atheistic)
  • Chemical evolution (first life)
  • Is evolution a theory or a fact?
  • Evolution is a theory AND a fact!
  • Fact - biological evolution has, and is
    occurring.
  • Theory explains many diverse facts from
    different scientific disciplines.

8
Science and Faith
  • The Crux of the Issue
  • Scientists are suspicious that Christians want to
    insert religious beliefs into science
  • Christians fear that science seeks to remove God
    from the picture altogether.
  • Are these suspicions and fears warranted?
  • Who will stop the cycle?

9
Understanding Randomness
  • Apparent random processes are biological
    realities.
  • Sperm/egg
  • Biochemical/physical reactions
  • Immunity
  • Random Mutation and Selection (Evolution)


10
(No Transcript)
11
DNA
Sugar
Hemoglobin
Cells
12
Antibodies
13
Genetic Record Chromosome Comparisons of Humans
and Apes
14
Understanding Randomness
  • Haphazard, coincidence, chance, purposeless.
  • Equal opportunity of occurrence! Biology as an
    equal opportunity process.

If random is defined as purposeless, then
connecting this dot to a purposeful God is
IMPOSSIBLE!
15
Is Anything Truly Random?
  • 21344321143223411342
  • 21344321143223411342
  • 21344321143223411342

16
Is Anything Truly Random?
  • 01123581321345589
  • (Fibonacci Numbers)

17
Is Anything Truly Random?
  • 213313424413241441323323223131
  • 213313424413241441323323223131
  • Adenine 1 Thymine 2 Cytosine 3
    Guanine 4
  • TACCACGTGGATGAGGACTCCTCTTCAGA
  • AUGGUGCACCUGACUCCUGAGGAGAAGUCU
  • Met - Val - His - Leu -Thr - Pro - Glu - Glu -
    Lys Ser
  • (Hemoglobin gene codes for Hemoglobin
    Protein)
  • It is music to the ear! Listen!

18
A Super Intelligence Would Know No True Randomness
  • EVERYTHING, regardless of deep complexity and
    apparent random nature, would actually possess
    logical, orderly, and purposeful connections.
  • Randomness and evolution need not detract from
    belief in God They can be viewed as part of a
    purposeful plan.

19
  • Fundamental Questions
  • --Does the creative logic revealed by science
    demonstrate the existence of a Creator?
  • OR
  • --Does the existence of innately creative
    natural laws eliminate God from the picture
    altogether?
  • Honest answers to honest questions

20
Random (Equal Opportunity) DesignA New Model for
Science EducationBuilding Bridges Instead of
Barriers
  • A New Direction Needed
  • Win/Win Each side granted core needs
  • Commit to solutions - Set positive examples.
  • Strengthen/affirm science and religious belief.
  • Recognize role of language/emotions.
  • Embrace and respect student diversity

21
Random (Equal Opportunity) Design A New Model
for Science Education Random Design - a powerful
process for creating higher order, especially in
living beings. Harnessing the laws of randomness,
it functions by first generating large arrays of
potential building blocks from which the most
suitable candidates are sequentially incorporated
into an ever-advancing architectural design.

22
Random (Equal Opportunity) Design A New Model
for Science Education How does Random Design
Work?
Random Design has three components 1. The
Driver imparts directionality to the world. 2.
The Mixer uses combinatorial mathematics to
create infinite new possibilities for diversity
the raw material for extending order and
structure. 3. The Selector.
23
Random (Equal Opportunity) Design A New Model
for Science Education How does Random Design
Work?
  • Question
  • Presented with a problem to solve and no
    limitations of time and resources, which of the
    following approaches would most likely arrive at
    the best solution?
  • Think the problem through as best as possible,
    then try what seems to be the one best idea.
  • Think the problem through as best as possible,
    then try the best 10 ideas.
  • Try all potential possibilities.

24
  • This expansive approach is biologys solution as
    well. In short, it is Random Design.
  • Examples
  • Four chemical bases of DNA -- infinite of
    genes.
  • Infinite genes -- infinite of proteins.
  • Infinite of proteins -- infinite diversity of
    life.

Key Point Random Design has virtually no
Limits! The magic of combinatorial mathematics
continuously searches for the very best solutions
to lifes dynamic and never-ending challenges -
the best, and perhaps only creative process up to
the task of beginning, nurturing, and sustaining
life on earth.
25
Random (Equal Opportunity) DesignA New Model for
Science Education
  • Strengthening Science
  • Recognizes that science must be free to pursue
    truth wherever it leads.
  • Refuses to redefine or compromise integrity of
    science to meet religious standards.
  • Does not explain biological processes and
    mechanisms in supernatural terms.

26
Random (Equal Opportunity) DesignA New Model for
Science Education
  • Strengthening Religious Faith
  • Permanent secure place for plausibility of
    Creator.
  • Ecumenical, offering a larger more expansive
    vision of God as Creator.
  • Restores credibility of religious
    representatives.
  • Viable platform to restore trust and
    relationships.

27
The Alpha and the Omega
About PowerShow.com