Great Dane x Mexican Chihuahua - PowerPoint PPT Presentation

Loading...

PPT – Great Dane x Mexican Chihuahua PowerPoint presentation | free to download - id: 23ff6c-ZDc1Z



Loading


The Adobe Flash plugin is needed to view this content

Get the plugin now

View by Category
About This Presentation
Title:

Great Dane x Mexican Chihuahua

Description:

Great Dane x Mexican Chihuahua. F1 Big (Great Danes) 3 Big : 1 Small. The Genius of Mendel ... Disease is apparent because of consanguinity (III 5 &6) ... – PowerPoint PPT presentation

Number of Views:93
Avg rating:3.0/5.0

less

Write a Comment
User Comments (0)
Transcript and Presenter's Notes

Title: Great Dane x Mexican Chihuahua


1
Great Dane x Mexican Chihuahua
F1 Big (Great Danes)
3 Big 1 Small
2
The Genius of Mendel
  • Highly inbred strains of peas
  • Differed by single character

Round x Wrinkled (WT x mutant) F1 All
Round F2 5474 Round 1850 Wrinkled 2.961
(31) Needs Statistics
3
(No Transcript)
4
Mapping in Drosophila
Ly Sb br

5
Lots of variation in people There must be a
genetic component How do we assign traits to
genes? Ultimately want a molecular
description Start with inherited diseases
6
(No Transcript)
7
PedigreesMendels First Law
Autosomal Dominant Disorder
8
Autosomal Recessive
Disease is apparent because of consanguinity
(III 5 6)
9
(No Transcript)
10
(No Transcript)
11
(No Transcript)
12
(No Transcript)
13
(No Transcript)
14
Population Genetics
Phenotypic GENOTYPIC
Science of Intraspecific Variation
  • Genotypic Variation Alleles, Polymorphism
  • Ultimate Source of Variation Mutation
  • Dynamics of Variation during Population History
  • Changes in Allele Frequencies due to
  • Drift
  • Selection
  • Persistence of Allele Combinations due to Linkage
  • Linkage Disequilibrium

15
Some Basics 1
1. Only refer to one strand, and dont confuse
strands with alleles
Allele 1
Allele 2
Allele 1
Allele 2
GATTACA
GATCACA
TGTAATC
TGTGATC

TGTAATC
TGTGATC
GATTACA
GATCACA
16
Some Basics 2
3. Because mutations are rare events, the vast
majority of variation is BINARY, at the base pair
level.
CAAAGGAAAAGAATGCCTTCCATTTTTGGCTGTGCCAAGAAGCTCAGAAA
GGTGATAATATAAAAAATATATAGTTAATTGGGAATTGAATTTACAAAAT
ACATT
Allele 1
Allele 2
CAAAGGAAAAGAATGCCTTCCATTTTTGGCTGTGCCAAGAAGCTCAGAAA
GGCGATAATATAAAAAATATATAGTTAATTGGGAATTGAATTTACAAAAT
ACATT
17
Some Basics 3
5. Alleles have frequencies in the population
(which sum to 1)
Frequency of Allele 1 (T) 0.59
Frequency of Allele 2 (C) 0.41
0.35
0.48
0.17
p2 2pq
q2
18
What about two different genes?
Consider two genes A and B that each have two
alleles A a
B b Allelic frequencies are 0.5 (At the
A locus A0.5, a 0.5) (At the B locus B0.5
and b0.5) For A and a genotype frequencies p2
2pq q2 AA , Aa and aa individuals 0.25 0.5
0.25 The same for BB, Bb and bb How many AA BB
individuals are (0.25 x 0.25) aa Bb individuals
are (0.25 x 0.50) Both genes are in
equilibrium. (Hardy and Weinberg)
19
Hardy Weinberg is the Population Equivalent of
the Punnett Square
a
A
A
AA
Aa
Aa
aa
a
(p q)2 p2 2pq q2
20
Mutation Rate per Generation
1 generation
How often per generation does this happen?
21
Haploid Human Genome is 2 x 109 base pairs Most
of the DNA is non-coding Introns, Intragenic
regions, LINES, SINES etc AT the DNA level, can
have tremendous variation ath no phenotypic
consequenses
22
Remember the LacI gene (the repressor) Nonsense
mutations at every codon Substitute every AA at
every position White means no phenotype Lesson.
most mutations in coding regions are silent
23
Drift vs. Selection
The two forces that determine the fate of alleles
in a population
  • Drift
  • Change in allele frequencies due to sampling
  • Selection
  • Change in allele frequencies due to function

24
Genetic Drift
25
This is like 107 independent populations
Gen 0
For every bottle after eggs hatch pick 8 male
larvae and 8 female larvae, stick in a new
bottle. Repeat for 19 generations.
26
Genetic Drift Size Matters
4 populations 2 at N25 2 at N250
From Li (1997) Molecular Evolution, Sinauer Press
27
Selection Fitness
Absolute Fitness Viability of
survivors / total progeny produced
P(survival until mean reproductive age)
If Fitness depends on Genotype, then we have
(natural) Selection
28
Selection vs Drift Recap
From the perspective of disease severity Given a
particular selection coefficient (picture
severity of disease), selection is only effective
in a population whose size is large enough to
overcome the effect of drift.
From the perspective of population size Given a
particular population size, only alleles that
bear a large enough selection coefficient
(picture severity of disease) will be strongly
selected against.
29
Linkage disequilibrium the big (and
oversimplified) picture
A new mutation! (on the "red" chromosome)
Eager geneticist obtains samples from multiple
affected individuals
  • Small number (maybe one) of ancestral
    disease-causing mutations
  • Isolation of chromosome bearing disease-causing
    mutation
  • "Reasonable" opportunity for recombination
    during population history
  • (Think Finland 1000 founders 2000 years ago
    consistent expansion)
  • Few (maybe none) reoccurrences of
    disease-causing mutation

30
LD and time history at work
Do we care about The age of the mutation or the
age of the founding population?
31
Two common types of DNA variants
32
DNA haplotype
  • Haplotype a series of marker alleles on a
    chromosome (DNA molecule)
  • E.g. DNA sequence, a series of SNPs or
    microsatellites along a chromosome.
About PowerShow.com