Genetic tools for metabolic enzyme production in Escherichia coli - PowerPoint PPT Presentation

Loading...

PPT – Genetic tools for metabolic enzyme production in Escherichia coli PowerPoint presentation | free to download - id: 1d89b6-ZDc1Z



Loading


The Adobe Flash plugin is needed to view this content

Get the plugin now

View by Category
About This Presentation
Title:

Genetic tools for metabolic enzyme production in Escherichia coli

Description:

Genetic tools for metabolic enzyme production in Escherichia coli. Jay D. Keasling ... Taxol. C-20 diterpene. Eleutherobin. C-20 Diterpene 50,000 known molecules ... – PowerPoint PPT presentation

Number of Views:149
Avg rating:3.0/5.0
Slides: 67
Provided by: jaydke8
Category:

less

Write a Comment
User Comments (0)
Transcript and Presenter's Notes

Title: Genetic tools for metabolic enzyme production in Escherichia coli


1
Genetic tools for metabolic enzyme production in
Escherichia coli
  • Jay D. Keasling
  • Department of Chemical Engineering
  • University of California
  • Berkeley, CA 94720

2
Terpenoids
Chemotherapeutics
gt 50,000 known molecules
Eleutherobin C-20 Diterpene
Taxol C-20 diterpene
3
Terpenoid metabolic pathways
4
The DXP pathway
pyridoxine
thiamine
Pyruvate
4-diphospho-2C-methyl-D-erythritol
Dxs
Dxr
IspD
2C-methyl-D-erythritol-4-phosphate (MEP)
1-deoxy-D-xylulose-5-phosphate (DXP)
D-glyceraldehyde- 3-phosphate (G3P)
IspE
IspF
Isopentenyl Pyrophosphate (IPP)
IspG
IspH
4-diphosphocytidyl-2C-methyl- D-erythritol-2-phosp
hate
2C-methyl-D-erythritol 2,4-cyclodiphosphate
1-hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate
Dimethylallyl Pyrophosphate (DMAPP)
5
The mevalonate pathway
6
Artemisinin
Artemisia annua
7
Artemisinin-based drugs
  • The current cost for an artemisinin-based drug is
    approximately 2.25.
  • Artemisinin generally adds 1.00-1.50 to the cost
    for drugs
  • Most developing countries spend less than
    4/person/year on health care
  • As many as 10-12 treatments are needed for each
    person annually
  • World Health Organization estimates that 700 tons
    will be needed annually

8
Microbial production of artemisinin
  • Advantages
  • Microbial fermentations are relatively simple to
    scale up
  • Inexpensive starting materials can be used
  • Challenges
  • Need the genes for all of the enzymes in the
    pathway
  • Not always simple to express in microbes the
    genes from very different organisms
  • Need to balance metabolic pathways to optimize
    production
  • Need a good platform organism with appropriate
    gene expression tools

9
Synthesis of artemisinin in E. coli
Identify the enzymes
10
Synthesis of artemisinin in E. coli
11
Synthesis of artemisinin in E. coli
Well characterized parts to control gene
expression
12
Synthesis of artemisinin in E. coli
Supply of intracellular precursors
13
Gene expression tools for metabolic engineering
Plasmid
14
Plasmid copy number can influence gene expression
levels
High-copy plasmid
Low-copy plasmid
15
dxs expressed from a high-copy plasmid
DMAPP
DXS
Pyr G3P
IPP
FPP
High-copy plasmid
CrtE
Ptac
dxs
CrtI
CrtY
Carotenoids
Pconst
crtE
crtI
crtY
16
Carotenoid production in cells expressing dxs
from a high-copy plasmid
7
6
5
4
Carotenoid (mg/ml)
3
2
1
0
0
0.3
0.6
0.9
IPTG concentration (mM)
17
Bacterial Artificial Chromosome (BAC)
0
F plasmid
25
75
50
ccd
Tn1000
oriS
flm
oriV
par
E
H
B
P
rep FIA
rep FIB
Native F plasmid of Escherichia coli
18
BACs are stable indefinitely in the absence of
selection pressure
1
Gene expression
0.8
induced
Not induced
0.6
Fraction plasmid- bearing cells
0.4
0.2
0
0
40
80
120
160
Culture time (generations)
19
Commonly-used high-copy plasmids are
segregatively unstable
1
Not induced
0.8
Fraction plasmid- bearing cells
0.6
Gene expression
0.4
induced
0.2
0
0
40
80
120
160
Culture time (generations)
20
The auxiliary chromosomes have improved control
of gene expression
Uninduced Expression
Induced Expression
Growth Rate of Host
0.69 hr-1
15 units
4,000 units
BAC
High-Copy Plasmid
0.53 hr-1
200 units
12,500 units
21
dxs expressed from a bacterial artificial
chromosome
DMAPP
DXS
Pyr G3P
IPP
FPP
Bacterial artificial chromosome
araC
CrtE
dxs
PBAD
CrtI
CrtY
Carotenoids
Pconst
crtE
crtI
crtY
22
Carotenoid production in cells expressing dxs
from a BAC
10.0
8.0
6.0
Cell growth (OD600nm) Lycopene (mg/ml)
4.0
2.0
0.0
0
0.013
0.133
1.33
13.3
Arabinose concentration (mM)
23
Carotenoid production in cells expressing dxs
24
Gene expression tools for metabolic engineering
Reproducible promoter control
25
The arabinose-inducible PBAD promoter
PC
Chromosome
Plasmid
ParaE
araC
araE
gfp
PBAD
inside
outside
26
The arabinose-inducible PBAD promoter
Plasmid
arabinose
Chromosome
PBAD
ParaE
gfp
araE
A
A
A
A
araC
PC
Green Fluorescent Protein
inside
outside
arabinose
27
Expression of gfp from the arabinose-inducible
promoter
100000
10000
Fluorescence/OD600
1000
100
0.00001
0.0001
0.001
0.01
0.1
1
10
Arabinose (wt )
28
Varying gene expression levels by varying
induction in individual cells
Average gene expression
Inducer concentration
29
Varying gene expression levels by varying the
number of induced cells
Average gene expression
Inducer concentration
30
Flow cytometric analysis
Laser
FALS sensor
Frequency
Fluorescence detector
Fluorescence
31
Varying gene expression levels by varying the
number of induced cells
32
Varying gene expression levels by varying
induction in individual cells
33
Native arabinose-inducible system gives rise to
two populations
Increasing inducer concentration
Fluorescence intensity
34
All-or-None Pathway Control
Pyruvate
Pyruvate
IPP
DMAPP
IPP
DMAPP
GPP
GPP
FPP
FPP
Amorphadiene
Amorphadiene
Artemisinin
Artemisinin
35
The arabinose-inducible PBAD promoter
arabinose
PBAD
gfp
araE
Pcon
PC
araC
GFP
inside
outside
arabinose
36
Population analysis of engineerined E. coli
expressing gfp
Increasing inducer concentration
Fluorescence intensity
37
Regulated Pathway Control
Pyruvate
Pyruvate
IPP
DMAPP
IPP
DMAPP
GPP
GPP
FPP
FPP
Amorphadiene
Amorphadiene
Artemisinin
Artemisinin
38
Gene expression tools for metabolic engineering
Expression of multiple genes
39
Balancing enzymatic reactions in the cell
A
Enzyme 4
Enzyme 1
X
Enzyme 3
Z
Y1
B
Enzyme 2
Y2
C
40
Using individual control elements
A
Enzyme 4
Enzyme 1
X
Enzyme 3
Z
Y1
B
Enzyme 2
Y2
C
41
Synthetic operons
P
DNA
mRNA
A
Enzyme 4
Enzyme 1
X
Enzyme 3
Z
Y1
B
Enzyme 2
Y2
C
42
RNase
mRNA
A
Enzyme 1
Enzyme 3
Enzyme 4
X
Y1
Z
B
Enzyme 2
Y2
C
43
Secondary structures in the mRNA protect natural
mRNAs against nucleases
ribosome
RBS
exonuclease
RNase E endonuclease
44
A cassette system to design mRNA stability
tccatacgtcgacggtaccgtattttggatgataacgaggcgcaaaaaat
g
aggtatgcagctgccatggcataaaacctactattgctccgcgtttttta
c
Sal I
Asp718
lacZ
Insertion of hairpin cassette
tccatacgtcgacttatctcgagtgagatattgttgacggtaccgtattt
tggatgataacgaggcgcaaaaaatg
aggtatgcagctgaatagagctcactctataacaactgccatggcataaa
acctactattgctccgcgttttttac
Transcription
45
A family of synthetic hairpins
46
A synthetic operon for carotenoid production
CrtE
CrtI
CrtY
Phytoene
Lycopene
b-Carotene
HPx
HP
crtY
crtI
p70yHPxi
3'
RNase E site
47
HP16
HP
crtY
crtI
5'
3'
3'
5'
5'
3'
CrtE
CrtI
CrtY
Phytoene
Lycopene
b-Carotene
48
Variation in hairpins
RNase E site
crtY
crtI
p70yi
5'
3'
HP17
crtY
crtI
p70yHP17i
3'
5'
HP4
crtY
crtI
p70yHP4i
5'
3'
HP16
crtY
crtI
p70yHP16i
5'
3'
49
Relative levels of carotenoids
CrtE
CrtI
CrtY
Phytoene
Lycopene
b-Carotene
50
Synthesis of artemisinin in cells
Artem.
FPP
51
Poor performance of plant sesquiterpene cyclases
5-epi-aristolochene
Low yields 0.05 to 0.7 ng/mL/OD Expression of
rare E. coli codon tRNA did not much help
Cadinene
Vetispiradiene
Martin et al., Biotech. Bioeng. 2001
52
Amorphadiene and artemisinin biosynthetic pathway
53
Assembly of rcAmorphadiene Cyclase
  • Take gene sequence from patent
  • Optimize sequence for expression in desired host
  • Synthesize 84 oligonucleotides of 40 basepairs
    each
  • Assemble into complete gene using the polymerase
    chain reaction (PCR)

54
Amorphadiene production by the synthetic
amorphadiene cyclase
142-fold improvement over other native
cyclases (100 ng/mL/OD)
55
Synthesis of artemisinin in cells
56
DXP pathway
pyridoxine
thiamine
Pyruvate
4-diphospho-2C-methyl-D-erythritol
Dxs
Dxr
IspD
2C-methyl-D-erythritol-4-phosphate (MEP)
1-deoxy-D-xylulose-5-phosphate (DXP)
D-glyceraldehyde- 3-phosphate (G3P)
IspE
IspF
Isopentenyl Pyrophosphate (IPP)
IspG
IspH
4-diphosphocytidyl-2C-methyl- D-erythritol-2-phosp
hate
2C-methyl-D-erythritol 2,4-cyclodiphosphate
1-hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate
Dimethylallyl Pyrophosphate (DMAPP)
57
Expression of genes known to limit production
Pyruvate
G3P
DXS
IPP
DMAPP
IdI
IspA
FPP
Amorphadiene
58
Amorphadiene production by the synthetic
amorphadiene cyclase
  • Additional 3-fold
  • (300 ng/mL/OD)

59
Intermediates in the DXP pathway are necessary
for growth
Pyruvate
G3P
DXP Pathway
pyridoxine
thiamine
IPP
DMAPP
GPP
Monoterpenes
FPP
Sesquiterpenes
GGPP
Diterpenes
Carotenoids
60
Mevalonate pathway
61
Construction of synthetic mevalonate pathway
operons
HMGS
atoB
tHMGR
MevT
(1.2kb)
(1.6kb)
P
(1.5kb)
Acetyl-CoA
Mevalonate
idi
PMK
MPD
MK
MBI
(1.2kb)
P
(1.3kb)
IPP DMAPP
(1.3kb)
(0.5kb)
Mevalonate
62
Amorphadiene from the full mevalonate pathway
Mevalonate pathway
30-fold improvement (3 mg/L/OD)
DXP pathway
63
Amorphadiene production in a two-phase
fermentation
64
Expression of plant mono-, sesqui-, and
di-terpenes cyclases in E. coli
FPP Sesquiterpenes
5-epi-aristolochene Tobacco
d-cadinene cotton
GGPP Diterpene
Vetispiradiene Hyoscyamus muticus
ent-Kaurene cyclase fungi
Casbene cyclase Castor bean
65
Design Rules for Doing Chemistry in Bacteria
  • Low copy number is generally better for
    reconstituting metabolic pathways
  • Consistent promoter control is essential for
    product and pathway homogeneity
  • Construction of operons and the use of mRNA
    stability is an efficient way to coordinate
    expression of multiple genes
  • Imbalances in gene expression can cause
    accumulation of intermediates and can be toxic to
    cells

66
Acknowledgements
Graduate Students Trent A. Carrier Kristala
Jones Christina Smolke Doug Pitera Sydnor
Withers Brian Pfleger Yasuo Yoshikuni
Post-docs Artem Khlebnikov Seon-Won Kim Vincent
Martin Jack Newman Kinkead Reiling
Funding National Science Foundation Office of
Naval Research Maxygen Diversa University of
California Discovery Grant
About PowerShow.com