Title: International Endogene Study finds strong evidence of susceptibility loci for endometriosis at two genomic regions
1BLOOD URINE COLLECTION
Set of blood collection tubes
1 x 4.5 ml. Citrate vacutainer Citrated plasma
2 x 9 ml. EDTA vacutainer DNA isolation and
EDTA-plasma
1 x 2 ml. EDTA vacutainer Measurement of HbA1c,
hemoglobin and hematocrit
2 x 9 ml. Heparin vacutainer RNA isolation
Urine collection set 2 x vacutainers, 1 x
adaptor Collection of urine
1 x 9 ml. Heparin vacutainer Isolation of
Leucocytes and heparin plasma
2BLOOD URINE COLLECTION
1 x 4.5 ml. Citrate vacutainer
1 x 2 ml. EDTA vacutainer
2 x 9 ml. EDTA vacutainer
2 x 9 ml. Heparin vacutainer
1 x 9 ml. Heparin vacutainer
2 x 10 ml. Urine
Store in melting ice during transport
Store in melting ice during transport
Tube A Freeze within 1 hr. Store in dry-ice
during transport Tube B Add challenger within
1 hr. Store at 37C during transport
Store at room temperature during transport
3EDTA DNA PLASMA
BLOOD HANDLING
2 x 9 ml. EDTA vacutainer
Store in melting ice during transport
Within 6 hr.
Centrifuge 20 min. 2000 G and 4C
Vacutainer with red cells, buffy- coat and rest
plasma
Collect plasma in plastic tube
Vortex shortly
lt1 hr RT
Store at -20 C
Division of plasma
18 Subsamples of 500 µl
lt1 hr RT
Snap-freezen
Store at lt-30 C
Methanol / Dry-ice
4Heparine RNA (rest challenge)
BLOOD HANDLING
2 x 9 ml. Heparine vacutainer
TUBE A
TUBE B
lt1 hr RT
lt1 hr RT
Add challenger
3 subsamples of 3 ml
Store at 37C during transport
Snap-freezen
After 6 hr. (exactly)
Methanol / Dry-ice
3 subsamples of 3 ml
Store in dry-ice during transport
Snap-freezen
Methanol / Dry-ice
After arrival at TNO Store atlt-60 C
Store atlt-60 C
5 Year 2004 to Nov only
6Array Based Genotyping Costs must reduce further
7AGRF Affymetrix Chip Genotyping Concordance and
fail rates
- Concordance comparison of samples with SNP fail
rate of lt 3 - Samples tested were an MZ twin pair, plus
parents (S3 and S4). - Genomic, Buccal and MDA Genomic replicates were
tested for each individual. - Sample MZ 2 Buccal was tested twice.
- Fail - no call for one or both samples
8Association Analysis
- Sharing between unrelated individuals
- Disease alleles originate in common ancestor
- High resolution
- Recombination since common ancestor
- Large number of independent tests
- Powerful if assumptions are met
- Same disease haplotype shared by many patients
- Sensitive to population structure
9Single Nucleotide Polymorphisms (SNP)
GGCTTCAGAATGGCCGGCTTCAAAATGGCC
- Single base changes
- Human SNPs 9,856,125
- - Validated SNPs 4,540,241
- Frequency 1 every 400 bp
- Can cause functional changes
10QIMRs Sequenom MassARRAY Installation (CCRC-E
floor)
11Multiplex Analysis
12SNP Genotyping
- Minimum Finished Genotypes (gt99)
- Quality of DNA
- Measure concentrations
- Dispense in large volumes
- Quality of Assays
- Even peak heights
- Test for Hardy-Weinberg equilibrium
- Analysis of SNP data is particularly sensitive to
assay problems - Genotype failures are not random
- Heterozygous individuals fail most often
- all SNP typing platforms
- Error frequency of 0.11
- 3268 DNA samples typed twice
- 159 pairs of MZ twins - No discordant genotypes
13Twelve-Plex Genotyping
14Whole Genome Association
- Use DNA pooling to greatly reduce amount of
genotyping - Possible now but reduced power
- Use haplotypes to reduce number of SNPs that have
to be genotyped - Haplotype blocks HapMap project
- Massive parallel genotyping
- Costs must reduce further