Human Genetics - PowerPoint PPT Presentation

Loading...

PPT – Human Genetics PowerPoint presentation | free to view - id: bf1f-Yzg2O



Loading


The Adobe Flash plugin is needed to view this content

Get the plugin now

View by Category
About This Presentation
Title:

Human Genetics

Description:

Human Genetics (Chapter 3: and some of 4) ... Can treat human diseases. eg severe combined immune deficiency syndrome (SCIDS) ... – PowerPoint PPT presentation

Number of Views:85
Avg rating:3.0/5.0
Slides: 61
Provided by: mazzm
Category:

less

Write a Comment
User Comments (0)
Transcript and Presenter's Notes

Title: Human Genetics


1
Human Genetics
  • (Chapter 3 and some of 4)

2
The structure of DNA
  • Composed of 4 nucleotide bases, 5 carbon sugar
    and phosphate.
  • Base pair rungs of a ladder.
  • Edges sugar-phosphate backbone.
  • Double Helix
  • Anti-Parallel

3
Figure 2.21
The structure of DNA
4
Figure 2.22a
DNA Replication
Remember the two strands run in opposite
directions Synthesis of a new (daughter) strand
occurs in the opposite direction of the old
(parental) strand. Complementary base-pairing
occurs A with T and G with C G and C have three
hydrogen bonds A and T have two hydrogen bonds
5
DNA Replication
  • Each new double helix is composed of an old
    (parental) strand and a new (daughter) strand.
  • As each strand acts as a template, process is
    called Semi-conservative Replication.
  • Replication errors can occur. Cell has repair
    enzymes that usually fix problem. An error that
    persists is a mutation.
  • This is permanent, and alters the phenotype.

6
The structure of RNA
  • Formed from 4 nucleotides, 5 carbon sugar,
    phosphate.
  • Uracil is used in RNA.
  • It replaces Thymine
  • The 5 carbon sugar has an extra oxygen.
  • RNA is single stranded.

7
Central Dogma of Molecular Biology
  • DNA holds the code
  • DNA makes RNA
  • RNA makes Protein
  • DNA to DNA is called REPLICATION
  • DNA to RNA is called TRANSCRIPTION
  • RNA to Protein is called TRANSLATION

8
Central Dogma of Molecular Biology
  • There are exceptions
  • Retroviruses
  • Use RNA as the genetic code
  • Must make DNA before making protein product
  • This new DNA makes RNA and then a protein
  • Also, one protein is not always the product of a
    single gene we will talk about this later in
    the course!

9
Figure 3.3 (1)
Transcription DNA to RNA
(RNA polymerase)
10
Figure 3.3 (2)
Transcription DNA to RNA
11
Figure 3.3 (3)
Transcription DNA to RNA
12
Figure 3.3 (4)
Transcription DNA to RNA
13
A close-up view of transcription
RNA nucleotides
RNA polymerase
Newly made RNA
Direction of transcription
Template strand of DNA
14
  • How does the order or sequence of nucleotides in
    a DNA and then a RNA molecule determine the order
    of amino acids in a protein? (Translation)

TACCTGAACGTACGTTGCATGACT
DNA
RNA
AUGGACUUGCAUCGAACGUACUGA
Met-Asp-Leu-His-Arg-Thr-Tyr-STOP
protein
15
Translation
  • Translation requires
  • Amino acids (AAs)
  • Transfer RNA (tRNA) Appropriate to its time,
    transfers AAs to ribosomes. The AAs join in
    cytoplasm to form proteins. 20 types. Loop
    structure
  • Ribosomal RNA (rRNA) Joins with proteins made in
    cytoplasm to form the subunits of ribosomes.
    Linear molecule.
  • Messenger RNA (mRNA) Carries genetic material
    from DNA to ribosomes in cytoplasm. Linear
    molecule.

16
Translation
  • The mRNA has a specific open reading frame made
    up of three base pairs codon.
  • The tRNA has the complementary base-pairing fit
    to the codon known as an Anticodon
  • Each of these codes for an amino acid

17
Translation
  • Initiation
  • mRNA binds to smaller of ribosome subunits, then,
    small subunit binds to big subunit.
  • AUG start codon--complex assembles
  • Elongation
  • add AAs one at a time to form chain.
  • Incoming tRNA receives AAs from outgoing tRNA.
    Ribosome moves to allow this to continue
  • Termintion Stop codon--complex falls apart

18
Figure 3.5 (1)
Translation
19
Figure 3.5 (2)
Translation
20
Figure 3.5 (3)
Translation
21
(No Transcript)
22
What happens when it all goes wrong?
  • MUTATIONS!!!!!!!!!!
  • two general categories
  • 1.result in changes in the amino acids in
    proteins
  • A change in the genetic code
  • 2.Change the reading frame of the genetic message
  • Insertions or deletions

23
Figure 3.6a
Mutations
24
Mutations
25
Remember Thalidomide?
  • The structure of thalidomide is similar to that
    of the DNA purine bases adenine (A) and guanine
    (G).
  • In solution, thalidomide binds more readily to
    guanine than to adenine, and has almost no
    affinity for the other nucleotides, cytosine (C)
    and thymine (T).
  • Furthermore, thalidomide can intercalate into
    DNA, presumably at G-rich sites.

26
Remember Thalidomide?
  • Thalidomide or one of its metabolites
    intercalates into these G-rich promoter regions,
    inhibiting the production of proteins and
    blocking development of the limb buds.
  • This intercalation would not significantly affect
    the over 90 per cent of genes that rely primarily
    on guanine sequences.
  • Most other developing tissues in the embryo rely
    on pathways without guanine, and are therefore
    not affected by thalidomide

27
Remember Thalidomide?
28
Genes can lead to inherited diseases
  • A gene which doesnt function on an autosomal
    chromosome can lead to devastating diseases
  • Autosomal chromosomes are 22 pairs of chromosomes
    which do not determine gender
  • Such diseases can be caused by both a dominant or
    a recessive trait

29
Autosomal Recessive Disorders
  • Tay-Sachs Disease
  • Jewish people in USA (E. Euro descent)
  • Not apparent at birth
  • 4 to 8 months
  • Neurological impairment evident
  • Gradually becomes blind and helpless
  • Develops uncontrollable seizures/paralyzed
  • Allele is on Chromosome 15
  • Lack of enzyme hexosaminidase A (Hex A)
  • Lysosomes dont work, build up in brain

30
Autosomal Recessive Disorders
  • Cystic Fibrosis
  • Most common in USA (Caucasian)
  • 1 in 20 caucasians is a carrier
  • Mucus in bronchial and pancreas thick/viscous
  • Breathing and food digestion problems
  • Allele is on chromosome 7
  • Cl ions can not pass through plasma membrane
    channels
  • Cl ions pass water goes with it. No water,
    thick mucus

31
(No Transcript)
32
Autosomal Recessive Disorders
  • Phenylketonuria (PKU)
  • Affects in in 5,000 newborns
  • Most common nervous system disorder
  • Allele is on chromosome 12
  • Lack the enzyme needed for the metabolism of the
    amino acid phenylalanine
  • A build up of abnormal breakdown pathway
  • Phenylketone
  • Accumulates in urine. If diet is not checked,
    can lead to severe mental retardation

33
Autosomal Dominant Disorders
  • Neurofibromatosis
  • Very common genetic disorder
  • Tan spots on skin
  • Later tumors develop
  • some sufferers have large head and ear and eye
    tumors.
  • Allele is on chromosome 17
  • Gene controls the production of a protein called
    neurofibromin
  • This naturally stops cell growth

34
Autosomal Dominant Disorders
  • Huntington Disease
  • Leads to degeneration of brain cells
  • Severe muscle spasms and personality disorders
  • Attacks in middle age
  • Allele is on chromosome 4
  • Gene controls the production of a protein called
    huntington
  • Too much AA glutamine. Changes size and shape of
    neurons

35
(No Transcript)
36
Incomplete Dominant traits
  • Sickle Cell Anemia
  • Controlled by intermediate phenotypes at a ratio
    of 121
  • Red blood cells are not concave
  • Normal Hemoglobin (HbA). Sickle cell (HbS)
  • HbA-HbA-normal Hbs-Hbs sickle cell
  • HbA-Hbs- have the trait

37
Mutations
- any change in the nucleotide sequence of DNA
Normal hemoglobin DNA
Mutant hemoglobin DNA
mRNA
mRNA
Sickle-cell hemoglobin
Normal hemoglobin
Glu
Val
Figure 10.21
38
Sickle Cell Anemia
39
Individual homozygousfor sickle-cell allele
Sickle-cell (abnormal) hemoglobin
Abnormal hemoglobin crystallizes, causing red
blood cells to become sickle-shaped
Sickled cells
Clumping of cells and clogging of small blood
vessels
Breakdown of red blood cells
Accumulation of sickled cells in spleen
Damage to other organs
Pain and fever
Physical weakness
Heart failure
Brain damage
Spleen damage
Anemia
Impaired mental function
Pneumonia and other infections
Kidney failure
Paralysis
Rheumatism
Figure 9.21
40
Genetic engineering
41
Genetic engineering
  • The direct alteration of a genotype
  • Human genes can be inserted into human cells for
    therapeutic purposes
  • Genes can be moved from one species to another
  • Moving genes from human to human or between
    species requires the use of special enzymes known
    as restriction enzymes.
  • These cut DNA at very specific sites
  • They restrict DNA from another species isolated
    from bacteria.

42
Figure 4.1
Genetic engineering
  • Each restriction enzyme cuts the DNA at a
    specific site, defined by the DNA sequence
  • Enzymes which produce sticky ends are more
    useful
  • Allows gene of interest to be inserted into a
    vector
  • Also need a DNA probe
  • Radioactive ssDNA that will bind to gene of
    interest so you can locate it

43
Genetic engineering
  • Transferred DNA is denatured to give ssDNA
  • The probe will bind to gene of interest by
    Complementary base-pairing - A with T and G with C

44
Figure 4.3 (1)
Genetically engineered insulin
45
Figure 4.3 (2)
Genetically engineered insulin
46
Figure 4.3 (3)
Genetically engineered insulin
47
Figure 4.3 (4)
Genetically engineered insulin
48
Genetically engineered insulin
  • Why do some people not like the idea?

The plasmid also needs a marker gene This is
usually an antibiotic resistance gene Some
people fear that the insulin which is extracted
from the bacteria would also contain a gene
product to make anyone who uses the insulin
resistant to antibiotics!
49
Gene therapy
  • Can treat human diseases
  • eg severe combined immune deficiency syndrome
    (SCIDS)
  • Bubble- Boy/Girl syndrome
  • The enzyme which causes this is on chromosome 20
  • Called adenosine deaminase (ADA)
  • Many problems
  • Difficult to transfer large genes
  • Insert in a way that the gene expresses to
    protein correctly
  • TRANSLATION!!!!!!!!!!!!

50
Figure 4.4 (1)
Gene therapy
51
Figure 4.4 (2)
Gene therapy
52
Figure 4.4 (3)
Gene therapy
53
Figure 4.4 (4)
Gene therapy
54
Figure 4.4 (5)
Gene therapy
Virus has genetic defect to prevent viral
reproduction and spreading to other cells
55
Figure 4.4 (6)
Gene therapy
Virus vector must get the gene into the nucleus
of the patients lymphocyte
56
Figure 4.4 (7)
Gene therapy
Gene has to be incorporated into cells DNA where
it will be transcribed Also inserted gene must
not break up some other necessary gene sequence
57
Gene therapy
  • The genetically engineered lymphocytes injected
    into the patient should out grow the natural
    (defective) lymphocytes
  • As ADA-deficient cells to not divide as fact as
    those with the active enzyme
  • Not permanent - need repeat injections as
    injected lymphocytes are mature and have limited
    life span
  • Stem cells would get around this problem (later!)

58
(No Transcript)
59
Genetic Profiling
  • We could screen everyones DNA for mutations.
  • How would this affect insurance?
  • How would this affect health care?
  • What about reproductive control?
  • What do you think?

60
The end!
  • Any questions?
About PowerShow.com