Title: Formation of a Consortium for Teaching Genomics: Genome Consortium for Active Teaching GCAT A. Malco
1Using DNA Microarrays from Multiple Species
Comparisons for Teaching Effectiveness
Todd T. Eckdahl Biology Department Missouri
Western State College
2Overview
- Background
- Courses using microarray technology
- Species studied
- Implementation
- Results
- Planned research projects
3Missouri Western State College
- Saint Joseph, Missouri
- State-supported PUI
- 5200 students
- 200 faculty
- Biology Department
- 340 majors
- 10 faculty
- No graduate degree programs
- New major in Biochemistry and Molecular Biology
4Courses Using Microarray Technology
- BIO 431 Molecular Biology
- 4 credit course
- 3 hours lecture, 3 hours lab
- Student majors
- BMB, Biology with Health Sciences emphasis
- BIO 313 Topics in Molecular Genetics
- 1 credit course
- 3 hours lab
- Student majors
- BMB, Biology-Health Sciences, Teaching
5Functional Genomics Technology
- Microarrays
- cDNAs printed
- eg. Stanford yeast chips, UW E. coli chips
- 80-mer oligos printed
- eg. ISB yeast chips
- Labeling options
- Indirect labeling
- eg. Genisphere dendrimers
- Direct incorporation
- eg. Ulysis alexafluore labeling
6Conducting Microarray Experiments in a Course
- Emphasize the Big Picture
- Genomics, functional genomics, proteomics
- Shift to data-rich science
- Primary Literature
- Brainstorming for ideas
- Scheduling
- Data Analysis
- Presentations
7Ideas for Yeast Experiments
- Glucose vs. Galactose vs. Fructose vs. Maltose
- Anaerobic vs. aerobic
- Induction of sporulation
- Heat Shock v. Cold Shock
- Drug treatment
8Minor Groove Binding Drugs
- Anti-tumor properties
- Conformational change in the 3D structure of DNA
- Prior Knowledge of MGBD/DNA interaction
- As models for minor
- groove binding proteins
DAPI
9Yeast Culture
- OD at 660 nm to measure turbidity
- Grown through log phase
- 4 hours of exposure to 10 uM DAPI
- Control culture without DAPI
10Isolation of RNA
- Sterile, RNase- free equipment and workspace
- Harvesting of yeast
- Production of spheroblasts
- Isolation of RNA via RNA spin column
- Elution of RNA
- Quantify RNA with A260 / A280
- Run RNA on denaturing agarose
11Preparation of labeled cDNA and hybridization
- Reverse transcription of RNA
- capture sequence incorporated
- Label preparation
- addition of Cy3 and Cy5 dendrimer
- addition of capturing reagents
- Add probe to slide, cover and incubate at 55 C
for 1-3 days
12Experimental Summary
Yeast in log phase
untreated
10 uM DAPI
Total RNA
Total RNA
Reverse Txn
cDNA
cDNA
Red fluorophore
Green fluorophore
microarray
hybridization
13Data Acquisition
- Post-hybe wash, dry slide
- Ship for scanning
- Receive data
- Scanalyze
- Submit to SMD
14(No Transcript)
15Microarray Controls
- Empty or 3X SSC
- Duplicate genes
- Duplicate experiments
- Cy3 and Cy5 dyes
- Poly A
- Genomic, Intron, tRNA
16Example of induced gene
YBR012W-B, TyB Gag-Pol protein TGAGAAGCTGTCATCGA
AGTTAGAGGAAGCTGAAGTGCAAGGATTGATAA
TGTAATAGGATAATGAAACATATAAAACGGAATGAGGAATAATCGCAAT
A TTAGTATGTAGAAATATAGATTCCATTTTGAGGATTCCTATATCCT
CGAG GAGAACTTCTAGTATATTCTGTATACCTAATATTATAGCCTTT
ATCAACA ATG
17Example of repressed gene
YHR055C, copper-binding metallothionein TTCCGCTGA
ACCGTTCCAGCAAAAAAGACTACCAACGCAATATGGATTGT CAGAATC
ATATAAAAGAGAAGCAAATAACTCCTTGTCTTGTATCAATTGC ATTAT
AATATCTTCTTGTTAGTGCAATATCATATAGAAGTCATCGAAATA GAT
ATTAAGAAAAACAAACTGTACAATCAATCAATCAATCATCACATAAA A
TG
18Analyses at Stanford Microarray Database
- Single spot or sequence
- Data filtering
- signal strength
- R/G or G/R ratio
- Linear regression comparison
- Prepare data for clustering
19Databases linked to SMD
- SGD - Saccharomyces genome database
- Genbank
- YPD - yeast protein database
- Swissprot protein database
20Ideas for E. coli Experiments
- Metabolic shift
- Osmotic stress
- Growth curve effects
- Heat Shock v. Cold Shock
- Drug treatment
- Effects of gene deletion
21BIO 313 Experiment
- E coli chips
- M1655 sequenced strain
- cDNA spotted
- Putative transcriptional regulators
- nusA deletion strain
- yhbM deletion strain
- Two channel hybridizations
- Compare labeled RNA from wt versus deletion
22(No Transcript)
23E. coli culture
- Overnight culture
- Grown at 37C to log phase
- OD at 600 nm to measure turbidity
24RNA Isolation
- Sterile, RNase-free equipment and work area
- Total RNA SafeKit
- Total RNA Safe protocol used
- Lysis of E. coli done with mixture of TE and
lysozyme
25RNA Isolates
- Measure A260 / A280
- Check on denaturing
- agarose gel
26Labeling
- Labeling of isolated RNA done by use of ULYSIS
Nucleic Acid Direct Labeling Kit - ULYSIS protocol followed
- Fluorescent Dyes Alexa Fluor 546 (green) and
Alexa Fluor 660 (red)
27Hybridization
- Microarray prehybridized
- Labeled RNA mixed together in hybridization
buffer and added to slide - Hyb at 55 C in dry incubator overnight
- Post-hyb washes
28Microarray Controls
- Empty or 3X SSC
- Duplicate genes
- Duplicate experiments
- Cy3 and Cy5 dyes
- Genomic
29Examples of Results
asr flhC emrY
30Examples
- Induced
- Asr, G1787881
- acid shock protein
- Repressed
- flhC, G1788201
- regulator of flagellar biosynthesis acting on
class 2 operons - Non-responsive
- emrY, G1788710
- multidrug resistance protein Y
- putative transport
31Example of induced gene
Asr, G1787881 gatca agactactattattggtagctaaatttccc
ttaagtcac aatacgttattatcaacgctgtaatttattcagcgtttg
tacatatcgttacacgctgaaaccaaccactcacggaag
tctgccattcccagggatatagttatttcaacggccccg
cagtggggttaaatgaaaaaacaaattgagggtatgaca 1 - atg
aaa aaa gta tta gct ctg gtt gtt gcc 31 - gct gct
atg ggt ctg tct tct gcc gcc ttt 61 - gct gca gag
act acg acc aca cct gct ccg 91 - act gcg acg acc
acc aaa gca gcg ccg gcg
32Example of repressed gene
flhC, G1788201 ccgca aatggttaagctggcagaaaccaatcaac
tggtttgtca cttccgttttgacagccaccagacgattactcagttgac
gcaagattcccgcgttgacgatctccagcaaattcatac
cggcatcatgctctcaacacgcttgctgaatgatgttaa
tcagcctgaagaagcgctgcgcaagaaaagggcctgatc 1 - atg
agt gaa aaa agc att gtt cag gaa gcg 31 - cgg gat
att cag ctg gca atg gaa ttg atc 61 - acc ctg ggc
gct cgt ttg cag atg ctg gaa 91 - agc gaa aca cag
tta agt cgc gga cgc ctg
33Example of non-responsive gene
emrY, G1788710 gaact catggaacaccccttgcgtattggtttat
cgatgacagc aactattgatacgaagaacgaagacattgccgagatgcc
tgagctggcttcaaccgtgacctccatgccggcttatac
cagtaaggctttagttatcgataccagtccgatagaaaa
agaaattagcaacattatttcgcataatggacaacttta 1 - atg
gca atc act aaa tca act ccg gca cca 31 - tta acc
ggt ggg acg tta tgg tgc gtc act 61 - att gca ttg
tca tta gcg aca ttt atg caa 91 - atg ttg gat tcc
act att tct aac gtc gca
34Microarrays in CoursesLessons Learned
- Advance planning essential
- Controls for critical steps
- Reliability and Reproducibility
- Do Controls Make Sense?
- Do Results Make Sense?
- Potential for large amounts of data means
extensive analysis time needed
35Ongoing and Planned Research Projects
- Measure Effects of Minor Groove Binding Drugs on
Gene Expression in Yeast - Measure Effects of Minor Groove Binding Drugs on
Gene Expression in Human Tumor Cells in Culture
36Big Ideas
- Sequence and structural requirements for MGBD
binding - AT rich sequences
- DNA bending
- Determination of optimal binding sites
- Effects of MGBDs on gene expression
- Preliminary data using RT-PCR
- Global patterns of gene expression
- Complementary in vitro and in vivo approaches
37Acknowledgements
- Genome Consortium for Active Teaching
- Malcolm Campbell, Davidson College
- NSF DBI 0099720 MUE grant
- Dr. Barbara Dunn, Stanford University
- Dr. Fred Blattner lab, UW-Madison
- Dr. Bob Getts, Genisphere, Inc.
- Missouri Western Students