Genomics, Medicine, and Society Francis S. Collins, M.D., Ph.D. National Human Genome Research Insti - PowerPoint PPT Presentation

Loading...

PPT – Genomics, Medicine, and Society Francis S. Collins, M.D., Ph.D. National Human Genome Research Insti PowerPoint presentation | free to view - id: 990d7-ODQ4M



Loading


The Adobe Flash plugin is needed to view this content

Get the plugin now

View by Category
About This Presentation
Title:

Genomics, Medicine, and Society Francis S. Collins, M.D., Ph.D. National Human Genome Research Insti

Description:

Genomics, Medicine, and Society Francis S. Collins, M.D., Ph.D. National Human Genome Research Insti – PowerPoint PPT presentation

Number of Views:432
Avg rating:3.0/5.0
Slides: 59
Provided by: gen69
Category:

less

Write a Comment
User Comments (0)
Transcript and Presenter's Notes

Title: Genomics, Medicine, and Society Francis S. Collins, M.D., Ph.D. National Human Genome Research Insti


1
Genomics, Medicine, and SocietyFrancis S.
Collins, M.D., Ph.D.National Human Genome
Research InstituteNational Institutes of Health,
USAInternational Conference on
GenomicsHangzhou, ChinaOctober 22, 2006
2
(No Transcript)
3
Collins et al., Nature 4/24/03
4
(No Transcript)
5
Collins et al., Nature 4/24/03
6
(No Transcript)
7
Collins et al., Nature 4/24/03
8
(No Transcript)
9
???????????????
A contribution to science and mankind by China.
10
(No Transcript)
11
(No Transcript)
12
We are getting DNA sequence on all of these
13
454 Sequencing Instrument
1) Prepare Adapter Ligated ssDNA Library
2) Clonal Amplification on 28 µ beads
3) Load beads and enzymes in PicoTiter Plate
4) Perform Sequencing by synthesis on the 454
Instrument
14
Solexa Clonal Single Molecule Arrays
Prepare DNA fragments
Ligate adapters
Attach single molecules to surface
Amplify to form clusters
1000 molecules per 1 um cluster 1000
clusters per 100 um square 40 million clusters
per experiment
15
The Real GrowthArea for DNA Sequencingis in
Medicine
  • Mendelian disorders
  • Common diseases candidate genes
  • Cancer

16
The Cancer Genome Atlas (TCGA)Pilot project
will start withGlioblastoma multiformeOvarian
cancerSquamous cell lung cancerMany
opportunities for international collaboration
17
The Real GrowthArea for DNA Sequencingis in
Medicine
  • Mendelian disorders
  • Common diseases candidate genes
  • Cancer
  • Next step complete genome sequencing
  • For research
  • As part of mainstream medical care

But meanwhile, how can we find the genetic
factors in diabetes, heart disease, mental
illness, and other common diseases?
18
(No Transcript)
19
Variant A
Variant B
Diabetic
Diabetic
Unaffected
Unaffected
20
Sequence from chromosome 7 GAAATAATTAATGTTTTCCTTC
CTTCTCCTATTTTGTCCTTTACTTCAATTTATTTATTTATTATTAATATT
ATTATTTTTTGAGACGGAGTTTCACTCTTGTTGCCAACCTGGAGTGCAGT
GGCGTGATCTCAGCTCACTGCACACTCCGCTTTCC/TGGTTTCAAGCGAT
TCTCCTGCCTCAGCCTCCTGAGTAGCTGGGACTACAGTCACACACCACCA
CGCCCGGCTAATTTTTGTATTTTTAGTAGAGTTGGGGTTTCACCATGTTG
GCCAGACTGGTCTCGAACTCCTGACCTTGTGATCCGCCAGCCTCTGCCTC
CCAAAGAGCTGGGATTACAGGCGTGAGCCACCGCGCTCGGCCCTTTGCAT
CAATTTCTACAGCTTGTTTTCTTTGCCTGGACTTTACAAGTCTTACCTTG
TTCTGCCTTCAGATATTTGTGTGGTCTCATTCTGGTGTGCCAGTAGCTAA
AAATCCATGATTTGCTCTCATCCCACTCCTGTTGTTCATCTCCTCTTATC
TGGGGTCACA/CTATCTCTTCGTGATTGCATTCTGATCCCCAGTACTTAG
CATGTGCGTAACAACTCTGCCTCTGCTTTCCCAGGCTGTTGATGGGGTGC
TGTTCATGCCTCAGAAAAATGCATTGTAAGTTAAATTATTAAAGATTTTA
AATATAGGAAAAAAGTAAGCAAACATAAGGAACAAAAAGGAAAGAACATG
TATTCTAATCCATTATTTATTATACAATTAAGAAATTTGGAAACTTTAGA
TTACACTGCTTTTAGAGATGGAGATGTAGTAAGTCTTTTACTCTTTACAA
AATACATGTGTTAGCAATTTTGGGAAGAATAGTAACTCACCCGAACAGTG
TAATGTGAATATGTCACTTACTAGAGGAAAGAAGGCACTTGAAAAACATC
TCTAAACCGTATAAAAACAATTACATCATAATGATGAAAACCCAAGGAAT
TTTTTTAGAAAACATTACCAGGGCTAATAACAAAGTAGAGCCACATGTCA
TTTATCTTCCCTTTGTGTCTGTGTGAGAATTCTAGAGTTATATTTGTACA
TAGCATGGAAAAATGAGAGGCTAGTTTATCAACTAGTTCATTTTTAAAAG
TCTAACACATCCTAGGTATAGGTGAACTGTCCTCCTGCCAATGTATTGCA
CATTTGTGCCCAGATCCAGCATAGGGTATGTTTGCCATTTACAAACGTTT
ATGTCTTAAGAGAGGAAATATGAAGAGCAAAACAGTGCATGCTGGAGAGA
GAAAGCTGATACAAATATAAATGAAACAATAATTGGAAAAATTGAGAAAC
TACTCATTTTCTAAATTACTCATGTATTTTCCTAGAATTTAAGTCTTTTA
ATTTTTGATAAATCCCAATGTGAGACAAGATAAGTATTAGTGATGGTATG
AGTAATTAATATCTGTTATATAATATTCATTTTCATAGTGGAAGAAATAA
AATAAAGGTTGTGATGATTGTTGATTATTTTTTCTAGAGGGGTTGTCAGG
GAAAGAAATTGCTTTTTTTCATTCTCTCTTTCCACTAAGAAAGTTCAACT
ATTAATTTAGGCACATACAATAATTACTCCATTCTAAAATGCCAAAAAGG
TAATTTAAGAGACTTAAAACTGAAAAGTTTAAGATAGTCACACTGAACTA
TATTAAAAAATCCACAGGGTGGTTGGAACTAGGCCTTATATTAAAGAGGC
TAAAAATTGCAATAAGACCACAGGCTTTAAATATGGCTTTAAACTGTGAA
AGGTGAAACTAGAATGAATAAAATCCTATAAATTTAAATCAAAAGAAAGA
AACAAACTA/GAAATTAAAGTTAATATACAAGAATATGGTGGCCTGGATC
TAGTGAACATATAGTAAAGATAAAACAGAATATTTCTGAAAAATCCTGGA
AAATCTTTTGGGCTAACCTGAAAACAGTATATTTGAAACTATTTTTAAA
Three single nucleotide polymorphisms (SNPs) are
present

21
Whole Genome Association Approach to Common
DiseaseThe View from 2002
  • Identify all 10 million common SNPs
  • Collect 1000 cases and 1000 controls
  • Genotype all DNAs for all SNPs
  • That adds up to 20 billion genotypes
  • At 50 cents a genotype, thats 10 billion for
    each disease

22
Sequence from chromosome 7 GAAATAATTAATGTTTTCCTTC
CTTCTCCTATTTTGTCCTTTACTTCAATTTATTTATTTATTATTAATATT
ATTATTTTTTGAGACGGAGTTTCACTCTTGTTGCCAACCTGGAGTGCAGT
GGCGTGATCTCAGCTCACTGCACACTCCGCTTTCC/TGGTTTCAAGCGAT
TCTCCTGCCTCAGCCTCCTGAGTAGCTGGGACTACAGTCACACACCACCA
CGCCCGGCTAATTTTTGTATTTTTAGTAGAGTTGGGGTTTCACCATGTTG
GCCAGACTGGTCTCGAACTCCTGACCTTGTGATCCGCCAGCCTCTGCCTC
CCAAAGAGCTGGGATTACAGGCGTGAGCCACCGCGCTCGGCCCTTTGCAT
CAATTTCTACAGCTTGTTTTCTTTGCCTGGACTTTACAAGTCTTACCTTG
TTCTGCCTTCAGATATTTGTGTGGTCTCATTCTGGTGTGCCAGTAGCTAA
AAATCCATGATTTGCTCTCATCCCACTCCTGTTGTTCATCTCCTCTTATC
TGGGGTCACA/CTATCTCTTCGTGATTGCATTCTGATCCCCAGTACTTAG
CATGTGCGTAACAACTCTGCCTCTGCTTTCCCAGGCTGTTGATGGGGTGC
TGTTCATGCCTCAGAAAAATGCATTGTAAGTTAAATTATTAAAGATTTTA
AATATAGGAAAAAAGTAAGCAAACATAAGGAACAAAAAGGAAAGAACATG
TATTCTAATCCATTATTTATTATACAATTAAGAAATTTGGAAACTTTAGA
TTACACTGCTTTTAGAGATGGAGATGTAGTAAGTCTTTTACTCTTTACAA
AATACATGTGTTAGCAATTTTGGGAAGAATAGTAACTCACCCGAACAGTG
TAATGTGAATATGTCACTTACTAGAGGAAAGAAGGCACTTGAAAAACATC
TCTAAACCGTATAAAAACAATTACATCATAATGATGAAAACCCAAGGAAT
TTTTTTAGAAAACATTACCAGGGCTAATAACAAAGTAGAGCCACATGTCA
TTTATCTTCCCTTTGTGTCTGTGTGAGAATTCTAGAGTTATATTTGTACA
TAGCATGGAAAAATGAGAGGCTAGTTTATCAACTAGTTCATTTTTAAAAG
TCTAACACATCCTAGGTATAGGTGAACTGTCCTCCTGCCAATGTATTGCA
CATTTGTGCCCAGATCCAGCATAGGGTATGTTTGCCATTTACAAACGTTT
ATGTCTTAAGAGAGGAAATATGAAGAGCAAAACAGTGCATGCTGGAGAGA
GAAAGCTGATACAAATATAAATGAAACAATAATTGGAAAAATTGAGAAAC
TACTCATTTTCTAAATTACTCATGTATTTTCCTAGAATTTAAGTCTTTTA
ATTTTTGATAAATCCCAATGTGAGACAAGATAAGTATTAGTGATGGTATG
AGTAATTAATATCTGTTATATAATATTCATTTTCATAGTGGAAGAAATAA
AATAAAGGTTGTGATGATTGTTGATTATTTTTTCTAGAGGGGTTGTCAGG
GAAAGAAATTGCTTTTTTTCATTCTCTCTTTCCACTAAGAAAGTTCAACT
ATTAATTTAGGCACATACAATAATTACTCCATTCTAAAATGCCAAAAAGG
TAATTTAAGAGACTTAAAACTGAAAAGTTTAAGATAGTCACACTGAACTA
TATTAAAAAATCCACAGGGTGGTTGGAACTAGGCCTTATATTAAAGAGGC
TAAAAATTGCAATAAGACCACAGGCTTTAAATATGGCTTTAAACTGTGAA
AGGTGAAACTAGAATGAATAAAATCCTATAAATTTAAATCAAAAGAAAGA
AACAAACTA/GAAATTAAAGTTAATATACAAGAATATGGTGGCCTGGATC
TAGTGAACATATAGTAAAGATAAAACAGAATATTTCTGAAAAATCCTGGA
AAATCTTTTGGGCTAACCTGAAAACAGTATATTTGAAACTATTTTTAAA
Are the SNPs correlated with their neighbors?

23
These three SNPs could theoretically occur in 8
different haplotypes
  • CAA
  • CAG
  • CCA
  • CCG
  • TAA
  • TAG
  • TCA
  • TCG

24
But in practice, only two are observed
  • CAA
  • CAG
  • CCA
  • CCG
  • TAA
  • TAG
  • TCA
  • TCG

25
www.hapmap.org
26
International HapMap Consortium Oct. 24, 2005
27
(No Transcript)
28
Whole Genome Association Approach to Common
Diseasein the HapMap Era
  • Identify an optimum set of 300,000 tag SNPs
  • Collect 1000 cases and 1000 controls
  • Genotype all DNAs for all SNPs
  • That adds up to 600 million genotypes
  • Genotyping just dropped to 0.003, so thats 2
    million for each disease, and that continues to
    drop

29
The First HapMap Success StoryAge-Related
Macular Degeneration
Two other risk variants have now been
identified. Together these account for 74 of
risk, and point to powerful new approaches to
prevention and treatment.
30
Other early results From HapMap
31
The major common variants for common diseases
like diabetes, schizophrenia, heart disease,
autism, hypertension, bipolar illness, asthma,
Alzheimers disease, osteoporosis, and many other
diseases should be identifiedin the next 2 3
years
32
What will be the impact of genomics on the
practice of medicine?
33
Disease with Genetic Component
34
Uterine Cancer 48
Colon Cancer 51
Colon Cancer 56
Coincidence or heredity?
35
Uterine Cancer 48
Colon Cancer 51
Colon Cancer 56
Genetic testing reveals that those with cancer
carry a mutation in MLH1
36
Uterine Cancer 48
Colon Cancer 51
Colon Cancer 56
Genetic testing reveals that two other family
members are at high risk
37
Disease with Genetic Component
38
Using Genetic Information to Predict Drug
Metabolism The AmpliChip CYP450
Frequency of CYP2D6 Phenotypes in Whites
Depending on your own spelling of the CYP450
genes, you may need much higher or much lower
doses of a many different drugs to get the
benefit.
Source Caraco, Y., N Engl J Med, 2004
39
Disease with Genetic Component
40
Hutchinson-Gilford Progeria Syndrome
Described clinically in 1886
Affected child
Cause identified in 2003 a mutation in the gene
for lamin A, a major structural protein of the
nucleus
41
Cellular hallmark of progeria nuclear blebbing,
which worsens as cells progressively age
42
Farnesyltransferase inhibitors (FTIs) correct
nuclear blebbing in progeria fibroblasts
43
Untreated Progeria mouse
150 mg/kg/d Progeria mouse
VSMCs ELASTIN PROTEOGLYCAN
450 mg/kg/d Progeria mouse
Normal mouse
44
Disease with Genetic Component
45
What About The Implications For Society?
46
Will effective policy solutions to
genetic discrimination be found?
47
Will knowledge of human variation reduce
prejudice, or increase it?
48
Will we arrive at consensus about the limits of
genetic technology for trait enhancement?
49
Will we succumb to genetic determinism,
neglecting the role of the environment, and
undervaluing the importance of human choices?
50
Personalized MedicineA future dream
51
Huas story in 2016
  • Hua has a careful family history taken at age 25,
    learns of uncles with early heart disease.
  • She consults her health care provider, who has
    made an effort to stay informed about genomic
    medicine. The provider suggests complete genome
    sequencing for 1000.
  • Hua inquires about the risk of genetic
    discrimination, but good public policy has
    outlawed this.
  • She is found to have three gene variants that
    have been shown conclusively in well validated
    studies to increase her risk of early heart
    attack 4-fold.
  • She and her provider design a program of
    prevention based on diet, exercise, and
    medication precisely targeted to her genetic
    situation.

52
Huas story continues
  • Hua does well until age 75.
  • She develops left arm pain that she assumes is
    due to gardening, but her provider knows her
    higher risk and diagnoses an acute MI.
  • Referring to her genome sequence, the provider
    chooses the drugs that will work best to treat
    her.
  • She survives and is alive and well in the 22nd
    century.

53
Personalized MedicineCould the dream become a
nightmare?
54
Huas story gone wrong
  • Hua never learns about her family history,
    educational efforts for the public and health
    care providers were never mounted, and Huas
    provider thought genetics was irrelevant to
    practice.
  • Hua hears about genome sequencing, but after
    seeing her brother lose his job from this
    information, she decides not to.
  • Hua eats an unhealthy diet, gains weight, and
    develops high blood pressure.
  • While tests to predict which drug would be most
    effective for Hua have been proposed, they have
    never been validated, and are not reimbursed.

55
Huas story gone wrong, continued
  • Huas hypertension is treated with a drug that
    causes a hypersensitivity reaction, so she stops
    treatment.
  • After 10 years of uncontrolled hypertension, Hua
    develops left arm pain at age 50.
  • Unaware of her high risk, her provider assumes
    this is musculoskeletal and prescribes rest.
  • Hua returns to the emergency room a few hours
    later in cardiogenic shock.
  • The absence of her genome sequence information
    prevents immediate optimum choice of therapy.
  • Hua dies in the emergency room.

56
Charge to all of us
  • SAVE HUA!!!

57
(No Transcript)
58
(No Transcript)
About PowerShow.com